Schema for Multiz 470-way - Multiz Alignment & Conservation (470 mammals)

JavaScript is disabled in your web browser

You must have JavaScript enabled in your web browser to use the Genome Browser

Database: hg38 Primary Table: multiz470way Data last updated: 2022-08-19
Big Bed File Download: https://hgdownload.soe.ucsc.edu/goldenPath/hg38/multiz470way/multiz470way.bigMaf
Item Count: 102,907,975
Format description: Bed3 with MAF block

field	example	description
`chrom`	chr1	Reference sequence chromosome or scaffold
`chromStart`	165970931	Start position in chromosome
`chromEnd`	165970968	End position in chromosome
`mafBlock`	a score=148232.000000;s hg38.chr1 165970931 37 + 248956422 gtatacatgtgccatgctggtgcgct--------gcaccc---------------------actaa;s HLhydIne1.SPDZ01001325 1517334 66 + 2050673 atccttctgggtcatcccagtgcaccagccccgagcaccctgtttcatgcatagaacctggactgg;i HLhydIne1.SPDZ01001325 C 0 I 5;s HLodoHem1.RCHL01007928 458526 66 + 475209 atccctctgggtcatcccagtgcaccagccttgagcaccctgtctcatgcatcgaacctagactgg;i HLodoHem1.RCHL01007928 I 142 I 5;s HLodoVir2.HiC_scaffold_5 106618418 66 - 108704129 atccctctgggtcatcccagtgcaccagccttgagcaccctgtctcatgcatcgaacctagactgg;i HLodoVir2.HiC_scaffold_5 I 142 I 5;s HLodoVir1.KZ101641 467952 66 + 485674 atccctctgggtcatcccagtgcaccagccttgagcaccctgtctcatgcatcgaacctagactgg;i HLodoVir1.KZ101641 I 142 I 5;s HLprzAlb1.SJXR01009206 34566 59 - 280119 -------tgggtcatcccagtgcaccagccccgagcaccctgtctcatgcatcgaacctggactgg;i HLprzAlb1.SJXR01009206 I 104 I 5;s HLaxiPor1.QQTR01012195 30542682 60 + 31895343 ------ctgggtcatcccagtgcaccagccccgagcaccctgtctcatgcatcaaacctggactgg;i HLaxiPor1.QQTR01012195 I 103 I 5;s HLalcAlc1.ML664832 1964659 23 + 1976280 -------------------------------------------ctcatgcatcgaacctggactgg;i HLalcAlc1.ML664832 I 188 I 5;s HLranTar1.PVIN010030589 13093 59 - 13447 -------tgggtcatcccagtgcaccagccctgagcaccttgtctcatgcatcgaacctagactgg;i HLranTar1.PVIN010030589 I 46 I 5;s HLranTarGra2.JACGUM010000225 4744051 59 + 5312034 -------tgggtcatcccagtgcaccagccctgagcaccttgtctcatgcatcgaacctagactgg;i HLranTarGra2.JACGUM010000225 I 104 I 5;e HLrapCam1.SJYW01029707 9143 15306 + 114583 I;e HLeidDup1.HiC_scaffold_17 1394624 0 + 41795121 C;e ptePar1.KE877502 3644 0 - 5637 C;e HLpteRuf1.HiC_scaffold_17 1867972 2096 - 47012030 I;e HLphiMax1.SJYS01016416 583843 12261 + 673455 I;e HLgulGul1.CYRY02002561 50736 1810 + 54642 I;e dasNov3.JH565955 435018 6213 - 499413 I;e HLmicHir1.PVJI01018860 13429 1717 + 32329 I;e HLnocLep1.PVIW01000294 103674 34 + 600511 I;e echTel2.JH980318 5514444 2496 - 39178583 I;e HLmicTal1.PVJH01023340 23176 352 + 34994 I;e speTri2.JH393291 2019313 1914 - 21495731 I;e HLtonSau1.PVIA01019905 1878 0 - 9615 C;e HLuroGra1.PVHY01060040 1508 114 - 2933 I;e HLuroPar1.QVIC01000428 1414839 1663 + 1775762 I;e HLcynGun1.WBRW01005482 97909 2305 + 298219 I;e HLspeDau1.KZ294332 1727565 2173 - 2136720 I;e HLmarMon2.WJEC01008620 264436 1302 - 414331 I;e HLmarMon1.CABDUW010002448 126856 1303 - 270978 I;e HLmarMar1.CZRN01000030 6205165 1250 - 30016984 I;e HLmarHim1.RAQP01000159 1853773 1478 - 2522713 I;e nanGal1.KL203549 3066758 1078 + 4310872 I;e HLonyTor1.LR877198 27590373 193 + 93020901 I;e HLpipPip1.PVIQ01030547 13865 0 - 15696 C;e HLpipKuh2.scaffold_m20_p_18 901351 0 + 26733270 C;e HLmarVan1.ML556011 219767 11068 + 585000 I;e HLmarFla1.ML561967 1940556 1301 - 4347674 I;e HLperCal2.VALE02034099 27844020 161 - 92652276 I;e HLperEre1.CACRXM010000011 30392609 980 - 98732353 I;e HLratRat7.CM021557 48468099 862 - 94975465 I;e rn6.chr13 28698230 890 - 114033958 I;e HLratNor7.CM026986 27464568 890 - 106807694 I;e HLtapInd2.HiC_scaffold_12 62071951 56 + 129325843 I;e HLmusAve1.PVJB01001313 83331 3658 - 164667 I;e HLlasBor1.PVJN01044231 7890 686 - 17355 I;e HLeulFul1.PVJU010037642 6049 0 - 17140 C;e HLcteSoc1.PVKA01015164 21430 2295 - 50891 I;e HLaeoCin1.JAAGEH010000042 2741757 514 + 32091567 I;e HLparHer1.PITB01010594 52908 11 + 61198 I;e HLpetTyp1.PVIR01038140 7601 1884 - 14169 I;e HLapoSyl1.LIPJ01022906 30375 3229 + 41181 I;e HLrhiSin1.LVEH01000252 1744597 2 + 2149339 I;e HLperLeu1.NMRJ01000025 3861690 1005 + 10235075 I;e HLacoCah1.PVKX01030354 15568 878 + 20787 I;e HLacoRus1.LR877217 26319212 809 - 89442464 I;e HLhysCri1.PVJO010014334 20713 2148 - 48630 I;e conCri1.JH655901 24411939 551 - 35080050 I;e HLdesRot2.ScWXtkA_1015 2135459 0 - 21003457 C;e HLlepYer1.Scaffold_198 1531173 0 + 3723489 C;e HLanoCau1.PVKU01002956 87248 2155 - 200592 I;e HLphyDis3.scaffold_m19_p_15 26372382 0 + 53102546 C;e HLmacCal1.VMDR010000015 695972 69 + 750106 I;e HLmorBla1.PVJD01007933 6363 2102 + 78103 I;e HLartJam2.VSFN01041186 1000945 2100 - 6238299 I;e HLstuHon1.VSFL01023575 2025660 0 + 15824623 C;e HLptePse1.BMBI01007204 212338 2097 - 1248589 I;e HLpteVam2.KN525958 163418 12049 - 1384543 I;e HLpteGig1.CACVBW010008835 1175648 2085 - 16648658 I;e HLsigHis1.PVIH01000948 231829 158 + 277295 I;e HLmusPah1.LT608292 27362018 955 - 167013402 I;e HLmusSpr1.CM004094 29514996 933 - 198846266 I;e HLarvNil1.CM022260 29050512 937 - 82689117 I;e HLcerHanYar1.CM021211 113892252 208 - 114290256 I;e HLtalOcc1.talOcc4_12 68510407 0 + 103479730 C;e HLcriGam1.PVKD010002854 3919 870 - 171351 I;e HLmyoGla2.LR761923 31517065 409 - 44647458 I;e HLmicAgr2.CADCXT010001961 5075495 1019 + 5137483 I;e proCoq1.NW_012138303v1 5365978 10 - 5416924 I;e HLcraTho1.PVKE010030094 18881 16 - 19836 I;e HLhipGal1.PVLB01058469 749 1 - 6858 I;e HLhipArm1.JXIK01000007 319322 1 + 8818463 I;e HLrhiFer5.scaffold_m29_p_21 2480568 2 + 53373475 I;e HLeidHel2.HiC_scaffold_5715 2552 0 - 13416 C;e HLeonSpe1.PUFA01000112 1761445 3661 - 6229622 I;e HLelaDav1.JRFZ01148360 2040709 168 - 2287170 I;e HLgraSur1.SRMG01000038 14575126 943 - 26868684 I;e HLmicArv1.VIIT010000291 292443 1145 - 297478 I;e HLmasCou1.VSBT01000001 28106936 1307 - 92586314 I;e HLondZib1.PVIU01001080 37112 1004 + 239226 I;e HLarvAmp1.LR862392 54532702 1013 + 115364413 I;e micOch1.chrUn_JH996500 175061 1346 + 2038552 I;e HLellLut1.LOEQ01001205 504956 178 + 691100 I;e HLneoLep1.LZPO01066370 146484 1037 - 267579 I;e HLgliGli1.PVJS01001058 82022 4653 + 106494 I;e HLmicFor1.NMRL01000092 1672807 245 - 6970285 I;e HLmicOec1.VIIU01001532 179773 225 - 229987 I;e HLperManBai2.CM010889 29418450 166 - 94517625 I;e mm39.chr1 28150693 1082 - 195154279 I;e mm10.chr1 28295954 1082 - 195471971 I;e HLmusSpi1.QGOO01036776 315176 1141 - 842199 I;e HLmusCar1.LT608242 27958617 939 - 185492789 I;e HLscaAqu1.PVIJ01001714 90528 438 + 187422 I;e cavApe1.AVPZ01000333v1 3257474 1306 + 19215827 I;e HLcasCan3.HiC_scaffold_15 44065258 7052 + 133442268 I;e HLsciVul1.LR738623 2540058 263 - 115298656 I;e HLxerIna1.PVHX01006948 71714 1604 - 95641 I;e HLdelLeu2.ML702083 574736 1172 + 6510507 I;e HLmonMon1.SIHG01006960 118901834 1172 - 179923342 I;e HLneoAsi1.KZ688176 158766 1136 - 820219 I;e HLphoSin1.CM018156 123270529 1136 + 185845356 I;e HLponBla1.PGGH01043597 1947 1164 - 24886 I;e ochPri3.JH802097 16426714 22332 + 20254952 I;e HLoryCun3.VIYN01000117 655892 10077 - 1120843 I;e oryCun2.chr13 116436830 10086 - 143360832 I;e HLoryCunCun4.CM023784 134753082 10094 + 163730721 I;e HLlepAme1.PVJM010030879 2197 9200 - 22830 I;e HLindInd1.RJWJ010007441 2972 2603 + 57695 I;e HLmirCoq1.PVHQ01015596 38647 0 - 41665 C;e HLmirZaz1.VSMD01121381 11503 1636 - 217702 I;e micMur3.chr2 128147606 3 + 141296404 I;e HLmicTav1.VSME01190269 43746 3 - 57336 I;e HLlemCat1.PVHV01001902 243660 1986 - 289509 I;e HLproSim1.MPIZ01128154 3557 2484 + 14633 I;e eulMac1.LGHX01002599v1 64280 3 - 87410 I;e HLphoPho1.RJWQ010002658 28698 1136 - 197028 I;e HLphoPho2.HiC_scaffold_13 112264256 2 + 168974331 I;e lipVex1.KE558978 162462 1173 + 5032892 I;e HLcatWag1.PVHT021183515 4042302 6 - 4602472 I;e canFam5.chr38 6342647 0 - 23826045 C;e HLcanLupDin1.QKWQ01001603 6455137 0 + 24034524 C;e canFam4.chr38 6674498 0 - 24803098 C;e HLlycPic3.HiC_scaffold_12 6084671 3 - 23682867 I;e HLlycPic2.SIDF01000129 3668775 3 + 5091347 I;e HLvulLag1.PISU010005175 24430 1 + 125717 I;e HLvulVul1.NBDQ01000009 3785623 1 + 32237033 I;e HLmusFur2.JAADYL010000150 2609957 0 - 23802291 C;e HLmusPut1.CABPTA010000809 3554052 0 + 27577820 C;e HLmusErm1.CM020584 9363567 0 - 70820203 C;e HLneoVis1.FNWR01000064 2692318 0 + 16237510 C;e enhLutKen1.chrUn_NW_019154109v1 3635701 0 - 27759331 C;e enhLutNer1.QQQE01000081v1 3473966 0 - 28056131 C;e HLlutLut1.LR738417 9483495 0 - 69992071 C;e HLlonCan1.ML974415 1129425 0 - 15535745 C;e HLpteBra1.PJEN01017298 11173 0 + 35883 C;e HLpteBra2.HiC_scaffold_5 8817857 0 + 65145824 C;e HLmarZib1.RDFD01009813 1245376 782 - 8926314 I;e HLtaxTax1.RCUC01112533 9335 1064 + 92602 I;e HLailMel2.CM022826 9362221 346 - 129245720 I;e HLeumJub1.ML137751 3753953 0 - 18344174 C;e HLzalCal1.CM019811 9823191 0 + 114255764 C;e HLarcGaz2.CAAAJK010002441 9396521 147 - 107010620 I;e HLcalUrs1.KZ836341 3796465 0 + 7414974 C;e HLodoRos1.HiC_scaffold_13 9618263 0 - 109853409 C;e odoRosDiv1.KB229247 851040 0 + 2539058 C;e HLmirLeo1.JAAMPH010000040 9344127 736 + 65650358 I;e HLmirAng2.HiC_scaffold_4 8729185 737 + 144390866 I;e lepWed1.KB717885 72044 14737 + 275771 I;e neoSch1.NW_018734376v1 3725243 736 - 12230506 I;e HLphoVit1.ML169415 3673256 426 + 27234606 I;e HLhalGry1.JAAXOB010000869 190187 427 + 2698223 I;e HLeriBar1.HiC_scaffold_7 8344455 427 - 140587879 I;e HLailFul2.HiC_scaffold_10 9087011 420 - 66873842 I;e HLspiGra1.PITA01022164 18502 97 + 30997 I;e HLmegLyr2.PVJL010002327 30255 27 + 204431 I;e HLursThi1.WEIE01000042 3498940 0 - 16730547 C;e HLursAme1.LZNR01000932 35050 0 + 122032 C;e HLursAme2.HiC_scaffold_3 49283639 0 + 107380712 C;e ursMar1.KK498545 3554891 0 - 16823045 C;e HLursArc1.KZ986311 3559594 0 + 16798251 C;e HLnasNar1.HiC_scaffold_18 9835337 0 + 59119919 C;e HLproLot1.HiC_scaffold_16 48441826 0 - 55297138 C;e HLbasSum1.HiC_scaffold_16 8091073 324 + 60924294 I;e HLpotFla1.HiC_scaffold_11 7572674 166 - 58894732 I;e HLantAme1.ML660219 4336372 3150 + 6317509 I;e HLmadKir1.SJYC01126094 14437 0 + 27235 C;e oryAfe1.JH863762 7410776 519 - 16276492 I;e chrAsi1.JH823605 494579 5568 + 2631008 I;e HLeleMax1.HiC_scaffold_13 165163276 2353 - 174872996 I;e triMan1.JH594751 5599665 12512 + 7231261 I;e HLdauMad1.PVJZ01001202 12898 3 + 500971 I;e HLgalVar2.PVJT020007402 4094716 3954 + 19745951 I;e HLcavTsc1.PVKK010018254 29468 2036 - 38324 I;e HLhydHyd1.PVLA01000902 430147 1947 - 434447 I;e HLdasPun1.RJWM01001394 15342 7 - 157635 I;e HLcoePre1.HiC_scaffold_31 22602310 0 + 35917382 C;e HLereDor1.ML655443 3974136 0 - 7466630 C;e dipOrd2.NW_012267273v1 11847607 846 + 13896254 I;e HLdipSte1.PVHN010017154 31385 627 - 36621 I;e HLperLonPac1.RJWR010029699 8231 486 + 18425 I;e HLperPol1.CM010913 27195188 164 - 97236207 I;e HLperCri1.HiC_scaffold_18 27174411 207 + 85546760 I;e HLperNas1.HiC_scaffold_10 25674387 177 + 82796891 I;e mesAur1.KB708154 3801319 1497 - 19452151 I;e HLrhoOpi1.REGO01000049 5326406 1017 + 7058760 I;e HLmerUng1.NHTI01000359 730264 1041 - 1006220 I;e HLpsaObe1.NESX02000374 1983204 1047 + 4230596 I;e tupChi1.KB320477 5447096 1276 + 6237175 I;e balAcu1.KI537437 190628 0 + 4583377 C;e HLequAsiAsi2.PSZQ01002953 2677180 204 + 3109186 I;e HLequAsi1.JREZ01000181 2863285 204 - 3804267 I;e HLequQuaBoe1.HiC_scaffold_13 30083311 28 + 99195765 I;e equCab3.chr5 68028625 28 - 96759418 I;e equPrz1.KK950764 178669 28 - 629914 I;e HLcerSimCot1.PVLE01025336 13357 2 + 27354 I;e cerSim1.JH767737 4050666 2 + 34426505 I;e HLdicBic1.PVJY020001475 3085743 2 - 3444273 I;e HLrhiUni1.HiC_scaffold_36 64037472 56 - 90415327 I;e HLtapTer1.PVID01016587 7501 56 + 18558 I;e HLpanLeo1.CM018477 48590150 1 + 63417951 I;e HLpanOnc2.HiC_scaffold_7 8508052 1 - 64254052 I;e HLpanOnc1.PISV01004510 90262 1 + 141822 I;e HLpanPar1.KV860319 4020871 1 - 19501849 I;e panTig1.KE721704 713641 1 + 2945509 I;e HLneoNeb1.HiC_scaffold_16 9483100 1 - 68542452 I;e HLaciJub2.QURD01000034 3706554 1 - 47062725 I;e HLpumCon1.QAVW01000547 3794512 853 + 19044873 I;e HLlynCan1.CM017345 9379332 1 - 69073222 I;e HLlynPar1.CAAGRJ010004009 1979079 1 - 5537880 I;e HLfelNig1.PISY01059390 1624 1 - 12053 I;e felCat9.chrF1 9657055 1 - 71664243 I;e HLpriBen1.BIMV01060370 16212 719 - 37398 I;e HLhelPar1.PJEM01001164 338711 1 - 340947 I;e HLsurSur1.CM016973 9404613 12 - 175818673 I;e HLsurSur2.PITD01006612 11689 12 - 106962 I;e HLcryFer2.HiC_scaffold_4 8890645 3 - 65496510 I;e HLpumYag1.JACEOH010000099 3793203 1 - 10574618 I;e HLhipAmp1.NKPW01001019 3273 6583 - 183982 I;e HLhipAmp3.PVJP02910765 2064836 4584 + 2465704 I;e HLmesBid1.PVJJ010000429 69030 1164 + 170128 I;e HLtraJav1.PVHZ021082378 1616656 14128 - 24678612 I;e HLgirCam2.HiC_scaffold_5 108287733 608 - 186479617 I;e HLgirTip1.LVKQ01S001580 170905 0 + 236403 C;e HLgirCam1.SJXV01002699 329358 0 + 2933752 C;e HLokaJoh2.HiC_scaffold_7 52962511 13 - 118624614 I;e HLcerEla1.CM008027 146045921 8288 - 149338601 I;e HLmunMun1.CM018501 213139284 168 + 1107743563 I;e HLmunRee1.CM018478 214036328 168 + 273513585 I;e HLcapPyg1.SNSB01003342 2335995 192 - 2841016 I;e HLmosChr1.SPDY01033332 20396 0 - 32595 C;e HLmosBer1.SGQJ01003839 1130899 0 + 1283815 C;e HLmosMos1.PVHU020001479 1728959 0 - 4852204 C;e HLtraScr1.SJXY01000607 3507328 0 + 5286092 C;e HLtraStr1.SJYU01001142 339115 0 + 646828 C;e HLtraImb1.SJYM01005787 74543 0 - 331680 C;e HLbosFro1.RBVW01000736 536435 0 + 1135252 C;e HLbosGau1.CM024437 34362283 0 + 123584006 C;e HLbosGru1.CM016692 15189269 0 + 132314468 C;e HLbosMut2.VBQZ03000147 1474507 0 + 4315505 C;e bosTau9.chr3 118094192 9 - 121005158 I;e HLbosInd2.CM009493 118448254 0 - 121419504 C;e bisBis1.KN265020v1 2077419 0 + 2538162 C;e HLsynCaf1.CABVSG010000014 5127381 0 - 38815046 C;e HLbubBub2.CM009845 117865222 13 - 120641659 I;e HLaepMel1.SJXQ01005896 126734 0 + 193975 C;e HLsylGri1.SJYH01007200 134320 0 - 190719 C;e HLcepHar1.SJYT01032414 63629 0 - 389927 C;e HLneoPyg1.SJYV01042474 11697 0 - 596184 C;e HLlitWal1.SJYG01000072 1226982 0 - 5226324 C;e HLeudTho1.SJYE01001021 1578885 0 - 2591050 C;e HLnanGra1.SJYD01049045 80301 0 + 424512 C;e HLproPrz1.SJYF01000241 3296179 0 + 6136367 C;e HLkobLecLec1.JACEGT010021558 677743 0 + 1037357 C;e HLkobEll1.SJYR01004004 150496 0 - 240495 C;e HLredRed1.SJYQ01000747 277024 0 + 832408 C;e HLhipEqu1.JAEFBM010000580 824548 601 - 3610040 I;e HLhipNig1.VHQK01014450 1078049 0 - 2122238 C;e HLoryDam1.HiC_scaffold_28 115609363 601 - 118425367 I;e HLoryGaz1.RAWW01012053 10346 0 - 333784 C;e HLdamLun1.SJXP01001784 464969 605 - 520974 I;e HLconTau2.HiC_scaffold_5 113955382 605 - 116815795 I;e HLcapAeg1.HG918828 1041708 0 + 1396922 C;e HLcapSib1.NIYN02032368 941806 0 - 10976654 C;e HLoreAme1.WJNR01003196 4992601 0 + 13368709 C;e HLammLer1.NIVO01059520 507659 0 - 1017214 C;e HLoviOri1.CM025414 119698617 0 + 282184360 C;e HLoviAri5.CM022019 123638200 616 + 287420779 I;e HLoviNivLyd1.CAFBRR010000269 1604090 0 - 2217174 C;e HLoviCan2.PVIS010022639 22471 0 + 35429 C;e HLhemHyl1.PVJR01003873 124112 0 - 137057 C;e HLoviCan1.CP011886 116265238 0 + 275920749 C;e panHod1.KE114483 288359 615 - 2993699 I;e HLchoHof3.HiC_scaffold_23 142922172 12121 + 236409553 I;e HLtapInd1.PVIE01006867 51061 56 + 92744 I;e HLdicSum1.PEKH010002845 229904 0 - 407674 C;e susScr11.chr4 46131228 6 - 130910915 I;e HLbalMys1.scaffold_1926 171157 1153 + 408032 I;e HLeubJap1.RJWP010015473 2151 1152 + 44747 I;e HLeubGla1.HiC_scaffold_16 112058948 0 + 169365006 C;e HLescRob1.RJWN010026536 14993 1156 - 18061 I;e HLbalEde1.HiC_scaffold_1 112951950 2 - 170613263 I;e HLbalMus1.VNFC01000001 122455876 1157 + 185157308 I;e HLmegNov1.RYZJ01001334 144759 1152 + 3217437 I;e HLbalPhy1.SGJD01001325 142581 1156 + 1196967 I;e HLbalBon1.DF525476 1940 1161 + 28296 I;e HLphyCat2.CM014788 58842576 0 + 147307960 C;e phyCat1.KI405086 143363 1167 + 219424 I;e HLkogBre1.RJWL010003049 70750 1394 - 84685 I;e HLzipCav1.RJWS010013356 2311 1818 + 19499 I;e HLsouChi1.RWJT01014841 217283 1172 - 875240 I;e HLlagObl1.ML065043 155482 1180 - 14203554 I;e HLgloMel1.ML658818 387653 1172 - 13166451 I;e HLpepEle1.HiC_scaffold_7 114680148 2 + 172691866 I;e HLturTru3.MRVK01002016 12295511 1172 + 13003681 I;e turTru2.JH481649 9572 1172 - 123971 I;e HLturTru4.CM022274 121121543 1172 - 183742880 I;e HLturAdu1.NCQN01002657 25888 1172 + 108004 I;e HLturAdu2.HiC_scaffold_19 123392854 1172 - 186145090 I;e orcOrc1.NW_004438446v1 180375 6 + 15399534 I;e HLlniGeo1.RJWO010000461 27053 1163 + 202818 I;e HLplaMin1.RJWK010025458 17003 1164 + 27673 I;e HLodoVir3.JAAVWD010002387 9923054 168 - 12267205 I;e HLantMar1.SJYB01000836 47345 0 + 69628 C;e HLcapHir2.CM004564 117252564 0 + 120038259 C;e HLdolPat1.PVJX010012056 1906 690 - 51541 I;e cavPor3.scaffold_39 3260379 1254 + 19227914 I;e tarSyr2.KE944892v1 72687 2194 + 342334 I;e HLchoDid1.PVKG010020056 1285 12072 + 20487 I;e HLchoDid2.NC_051308 149401467 12074 - 248084734 I;e HLmunMug1.PISW01003653 139876 75 - 197631 I;e HLphaTri2.HiC_scaffold_39 26205625 11 + 29901713 I;e HLmanTri1.SOZM010030527 13838 11 - 23408 I;e HLcroCro1.VOAJ01002537 5968850 1 - 6090100 I;e HLhyaHya1.PEQU01001221 184013 1 - 496542 I;e HLsciCar1.LR738602 2277538 280 - 118645147 I;e HLfukDam2.JAAHWF010000019 26415041 6036 - 68974913 I;e hetGla2.JH602139 4278495 2635 + 8736462 I;e octDeg1.JH651631 8848062 2629 - 9441191 I;e HLmyoCoy1.PVJA010008441 44865 1178 - 64165 I;e chiLan1.JH721922 3975298 925 - 14742515 I;e HLdinBra1.PVLD010022658 9953 244 + 28898 I;e HLrhiPru1.VZQC01002755 640468 8151 + 5675952 I;e HLzapHud1.PVHP010010534 25374 1197 - 47410 I;e jacJac1.JH725442 1975962 1705 - 52350410 I;e HLallBul1.PVKW010050289 2799 2848 + 13517 I;e HLeulFla1.HiC_scaffold_1 2573087 3 + 121055598 I;e eulFla1.LGHW01002624v1 65550 3 - 88687 I;e HLeulMon1.HiC_scaffold_8 1711927 0 - 110213302 C;e HLcheMed1.VBSM01000662 3813434 3 + 15443601 I;e HLcalPym1.HiC_scaffold_22 15821138 5 + 39273693 I;e HLcalJac4.CM021932 17648203 5 - 47063576 I;e HLsagImp1.PVHO010012111 46145 5 + 69038 I;e cebCap1.NW_016107399v1 2759826 0 + 7184330 C;e HLsapApe1.ML771924 3972028 4983 - 26995591 I;e saiBol1.JH378132 896044 5 + 23605852 I;e HLsaiBol1.HiC_scaffold_17 11254565 5 - 36116915 I;e HLateGeo1.PVHS01000350 83241 0 - 302544 C;e HLpleDon1.PVKP010013225 55724 0 - 56092 C;e HLpitPit1.PVIP01002163 147217 0 + 181692 C;e rhiBie1.NW_016811785v1 637335 1569 - 762331 I;e HLrhiRox2.CM017358 116082935 1565 + 145729886 I;e nasLar1.chr1 184764871 8813 + 215897965 I;e HLtraFra1.VVIV01001011 22962425 1569 + 149663456 I;e HLsemEnt1.PVII010018490 27289 1565 - 38648 I;e colAng1.NW_012113808v1 6498279 1575 + 9738959 I;e HLpilTep2.CM019240 22948366 1567 + 221045333 I;e chlSab2.chr25 22872125 0 - 85787240 C;e HLeryPat1.PVJV010033313 25319 0 - 25681 C;e HLallNig1.HiC_scaffold_21 21535504 678 - 203016725 I;e HLcerNeg1.PVKI010086321 8187 0 - 8638 C;e HLcerMon1.JABBCR010000853 3463377 0 + 44144928 C;e rheMac10.chr1 23463618 0 + 223616942 C;e HLmacFus1.HiC_scaffold_8800 1381 0 - 1729 C;e HLmacFas6.BLPH01000001 23381694 0 + 222129363 C;e macNem1.NW_012011511v1 3145307 0 + 7430828 C;e manLeu1.NW_012102110v1 340522 0 + 5196377 C;e HLmanSph1.SRPC01002599 756 0 + 4314964 C;e cerAty1.NW_012002257v1 3103391 31 + 3986814 I;e HLtheGel1.CM009950 23569040 0 - 222973213 C;e HLpapAnu5.CM018180 23142724 0 - 218172882 C;e HLnomLeu4.CM016956 70981979 0 - 106591116 C;e HLhylMol2.WKKJ02000008 60273597 0 - 127976207 C;e ponAbe3.chr1 143417763 0 - 227913704 C;e gorGor6.chr1 136698176 0 + 219763114 C;e panTro6.chr1 141009309 0 + 224244399 C;e panPan3.chr1 141402250 0 + 224621958 C;	MAF block

Sample Rows

chrom	chromStart	chromEnd	mafBlock
chr1	165970931	165970968	a score=148232.000000;s hg38.chr1 165970931 37 + 248956422 gtatacatgtgccatgctggtgcgct--------gcaccc------ ...
chr1	165970968	165971096	a score=1435904.000000;s hg38.chr1 165970968 128 + 248956422 tgtgtcatctagcattaggtatatctcccaatgctatccctccc ...
chr1	165971096	165971231	a score=1221112.000000;s hg38.chr1 165971096 135 + 248956422 tgagtgagaatatgcggtgtttggttttttgttcttgcgatagt ...
chr1	165971231	165971526	a score=2577550.000000;s hg38.chr1 165971231 295 + 248956422 atatgtgcca---cattttcttaatccagtctatcattgttgga ...
chr1	165971526	165971574	a score=245313.000000;s hg38.chr1 165971526 48 + 248956422 gttgtt--------------t--cctgactttttaatgattgccat ...
chr1	165971574	165971669	a score=491469.000000;s hg38.chr1 165971574 95 + 248956422 atatctcatagtggttttgatttgcatttctctgatggccagtgat ...
chr1	165971669	165971885	a score=942592.000000;s hg38.chr1 165971669 216 + 248956422 agaagtgtctgttcatgtccttcgccca-ctttttgatggggttg ...
chr1	165971885	165972153	a score=951114.000000;s hg38.chr1 165971885 268 + 248956422 caattttggcttttgttgccattgcttttggtgttttggacatga ...
chr1	165972153	165972571	a score=1585864.000000;s hg38.chr1 165972153 418 + 248956422 tttgtcaaagatcagatagttgtaggtatgcggcgttatttctg ...
chr1	165972571	165972779	a score=777599.000000;s hg38.chr1 165972571 208 + 248956422 aggtccttcacatcccttgtaagttggattcc--taggtat-ttt ...

Multiz 470-way (cons470way) Track Description

Data Access

Downloads for data in this track are available:

Multiz alignments (bigMaf and MAF format), and phylogenetic trees
PhyloP conservation (bigWig and WIG format)
PhastCons conservation (bigWig and WIG format)

Description

This track shows multiple alignments of 470 mammal assemblies and measurements of evolutionary conservation from the Michael Hiller Lab. There is some duplication of different assemblies for the same species, hence there are 431 distinct species in this collection.

The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track.

The base-wise conservation scores are computed using two methods phastCons and phyloP from the PHAST package, for all species.

PhastCons (which has been used in previous Conservation tracks) is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

The genome assemblies are from a variety of sources. Some are equivalent to UCSC genome browser assemblies, some are from NCBI Genbank assemblies, and some are from the DNA Zoo. When available in the UCSC browser system, links are provided in the table below. Otherwise, links are provided to source locations for the assemblies.

count common
name clade scientific
name assembly
link to browser when available, or assembly source taxon id
link to NCBI

1 human primates Homo sapiens Dec. 2013 (GRCh38/hg38) 9606

2 chimpanzee Primates Pan troglodytes Jan. 2018 (Clint_PTRv2/panTro6) 9598

3 pygmy chimpanzee Primates Pan paniscus May 2020 (Mhudiblu_PPA_v0/panPan3) 9597

4 western lowland gorilla Primates Gorilla gorilla gorilla Aug. 2019 (Kamilah_GGO_v0/gorGor6) 9595

5 Sumatran orangutan Primates Pongo abelii Jan. 2018 (Susie_PABv2/ponAbe3) 9601

6 northern white-cheeked gibbon Primates Nomascus leucogenys HLnomLeu4 GCA_006542625.1 61853

7 silvery gibbon Primates Hylobates moloch HLhylMol2 GCA_009828535.2 81572

8 pig-tailed macaque Primates Macaca nemestrina Mar. 2015 (Mnem_1.0/macNem1) 9545

9 gelada Primates Theropithecus gelada HLtheGel1 GCA_003255815.1 9565

10 crab-eating macaque Primates Macaca fascicularis HLmacFas6 GCA_012559485.1 9541

11 Mona monkey Primates Cercopithecus mona HLcerMon1 GCA_014849445.1 36226

12 Ugandan red Colobus Primates Piliocolobus tephrosceles HLpilTep2 GCA_002776525.3 591936

13 Angolan colobus Primates Colobus angolensis palliatus Mar. 2015 (Cang.pa_1.0/colAng1) 336983

14 drill Primates Mandrillus leucophaeus Mar. 2015 (Mleu.le_1.0/manLeu1) 9568

15 sooty mangabey Primates Cercocebus atys Mar. 2015 (Caty_1.0/cerAty1) 9531

16 olive baboon Primates Papio anubis HLpapAnu5 GCA_008728515.1 9555

17 mandrill Primates Mandrillus sphinx HLmanSph1 GCA_004802615.1 9561

18 Hanuman langur Primates Semnopithecus entellus HLsemEnt1 GCA_004025065.1_SemEnt_v1_BIUU 88029

19 Rhesus monkey Primates Macaca mulatta Feb. 2019 (Mmul_10/rheMac10) 9544

20 Japanese macaque Primates Macaca fuscata DNA zoo Macaca fuscata 9542

21 Francois's langur Primates Trachypithecus francoisi HLtraFra1 GCA_009764315.1 54180

22 black snub-nosed monkey Primates Rhinopithecus bieti Aug. 2016 (ASM169854v1/rhiBie1) 61621

23 golden snub-nosed monkey Primates Rhinopithecus roxellana HLrhiRox2 GCA_007565055.1 61622

24 Red shanked douc langur Primates Pygathrix nemaeus HLpygNem1 GCA_004024825.1_PygNem_v1_BIUU 54133

25 De Brazza's monkey Primates Cercopithecus neglectus HLcerNeg1 GCA_004027615.1_CertNeg_v1_BIUU 36227

26 proboscis monkey Primates Nasalis larvatus Nov. 2014 (Charlie1.0/nasLar1) 43780

27 Allen's swamp monkey Primates Allenopithecus nigroviridis DNA zoo Allenopithecus nigroviridis 54135

28 green monkey Primates Chlorocebus sabaeus Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2) 60711

29 red guenon Primates Erythrocebus patas HLeryPat1 GCA_004027335.1_EryPat_v1_BIUU 9538

30 white-faced saki Primates Pithecia pithecia HLpitPit1 GCA_004026645.1_PitPit_v1_BIUU 43777

31 black-handed spider monkey Primates Ateles geoffroyi HLateGeo1 GCA_004024785.1_AteGeo_v1_BIUU 9509

32 Ma's night monkey Primates Aotus nancymaae Jun. 2017 (Anan_2.0/aotNan1) 37293

33 Bolivian titi Primates Plecturocebus donacophilus HLpleDon1 GCA_004027715.1_CalDon_v1_BIUU 230833

34 mantled howler monkey Primates Alouatta palliata HLaloPal1 GCA_004027835.1_AloPal_v1_BIUU 30589

35 Bolivian squirrel monkey Primates Saimiri boliviensis DNA zoo Saimiri boliviensis 27679

36 tamarin Primates Saguinus imperator HLsagImp1 GCA_004024885.1_SagImp_v1_BIUU 9491

37 Bolivian squirrel monkey Primates Saimiri boliviensis boliviensis Oct. 2011 (Broad/saiBol1) 39432

38 white-tufted-ear marmoset Primates Callithrix jacchus HLcalJac4 GCA_011100555.1_mCalJac1.pat.X 9483

39 pygmy marmoset Primates Callithrix pygmaea DNA zoo Callithrix pygmaea 9493

40 tufted capuchin Primates Sapajus apella HLsapApe1 GCA_009761245.1 9515

41 Panamanian white-faced capuchin Primates Cebus capucinus imitator Apr. 2016 (Cebus_imitator-1.0/cebCap1) 2715852

42 white-fronted capuchin Primates Cebus albifrons HLcebAlb1 GCA_004027755.1_CebAlb_v1_BIUU 9514

43 aye-aye Primates Daubentonia madagascariensis HLdauMad1 GCA_004027145.1_DauMad_v1_BIUU 31869

44 Coquerel's sifaka Primates Propithecus coquereli Mar. 2015 (Pcoq_1.0/proCoq1) 379532

45 babakoto Primates Indri indri HLindInd1 GCA_004363605.1_IndInd_v1_BIUU 34827

46 brown lemur Primates Eulemur fulvus HLeulFul1 GCA_004027275.1_EulFul_v1_BIUU 13515

47 Sclater's lemur Primates Eulemur flavifrons Aug. 2015 (Eflavifronsk33QCA/eulFla1) 87288

48 Ring-tailed lemur Primates Lemur catta HLlemCat1 GCA_004024665.1_LemCat_v1_BIUU 9447

49 greater bamboo lemur Primates Prolemur simus HLproSim1 GCA_003258685.1 1328070

50 mongoose lemur Primates Eulemur mongoz DNA zoo Eulemur mongoz 34828

51 Sclater's lemur Primates Eulemur flavifrons DNA zoo Eulemur flavifrons 87288

52 Lesser dwarf lemur Primates Cheirogaleus medius HLcheMed1 GCA_008086735.1 9460

53 black lemur Primates Eulemur macaco Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1) 30602

54 Philippine tarsier Primates Carlito syrichta Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2) 1868482

55 gray mouse lemur Primates Microcebus murinus Feb. 2017 (Mmur_3.0/micMur3) 30608

56 Northern giant mouse lemur Primates Mirza zaza HLmirZaz1 GCA_008750895.1 339999

57 Coquerel's mouse lemur Primates Mirza coquereli HLmirCoq1 GCA_004024645.1_MizCoq_v1_BIUU 47180

58 mouse lemur Primates Microcebus sp. 3 GT-2019 HLmicSpe31 GCA_008750915.1 2508170

59 Northern rufous mouse lemur Primates Microcebus tavaratra HLmicTav1 GCA_008750935.1 143351

60 slow loris Primates Nycticebus coucang HLnycCou1 GCA_004027815.1_NycCou_v1_BIUU 9470

61 small-eared galago Primates Otolemur garnettii Mar. 2011 (Broad/otoGar3) 30611

62 Sunda flying lemur Euarchontoglires Galeopterus variegatus HLgalVar2 GCA_004027255.2 482537

63 Chinese tree shrew Euarchontoglires Tupaia chinensis Jan 2013 (TupChi_1.0/tupChi1) 246437

64 northern tree shrew Euarchontoglires Tupaia belangeri Dec. 2006 (Broad/tupBel1) 37347

65 puma Carnivora Puma concolor HLpumCon1 GCA_003327715.1_PumCon1.0 9696

66 Amur tiger Carnivora Panthera tigris altaica 06 Sep 2013 (PanTig1.0/panTig1) 74533

67 Clouded leopard Carnivora Neofelis nebulosa DNA zoo Neofelis nebulosa 61452

68 leopard Carnivora Panthera pardus HLpanPar1 GCA_001857705.1_PanPar1.0 9691

69 bearded seal Carnivora Erignathus barbatus DNA zoo Erignathus barbatus 39304

70 jaguar Carnivora Panthera onca HLpanOnc1 GCA_004023805.1_PanOnc_v1_BIUU 9690

71 harbor seal Carnivora Phoca vitulina HLphoVit1 GCA_004348235.1 9720

72 cheetah Carnivora Acinonyx jubatus HLaciJub2 GCF_003709585.1_Aci_jub_2 32536

73 gray seal Carnivora Halichoerus grypus HLhalGry1 GCA_012393455.1 9711

74 Hawaiian monk seal Carnivora Neomonachus schauinslandi Jun. 2017 (ASM220157v1/neoSch1) 29088

75 Weddell seal Carnivora Leptonychotes weddellii Mar 2013 (LepWed1.0/lepWed1) 9713

76 jaguar Carnivora Panthera onca DNA zoo Panthera onca 9690

77 Amur leopard cat Carnivora Prionailurus bengalensis euptilurus HLpriBen1 GCA_005406085.1 300877

78 Asian black bear Carnivora Ursus thibetanus thibetanus HLursThi1 GCA_009660055.1 441215

79 Spanish lynx Carnivora Lynx pardinus HLlynPar1 GCA_900661375.1 191816

80 Southern elephant seal Carnivora Mirounga leonina HLmirLeo1 GCA_011800145.1 9715

81 Canada lynx Carnivora Lynx canadensis HLlynCan1 GCA_007474595.1 61383

82 Northern elephant seal Carnivora Mirounga angustirostris DNA zoo Mirounga angustirostris 9716

83 lion Carnivora Panthera leo HLpanLeo1 GCA_008795835.1 9689

84 walrus Carnivora Odobenus rosmarus DNA zoo Odobenus rosmarus 9707

85 northern fur seal Carnivora Callorhinus ursinus HLcalUrs1 GCA_003265705.1 34884

86 Pacific walrus Carnivora Odobenus rosmarus divergens Jan 2013 (Oros_1.0/odoRosDiv1) 9708

87 giant panda Carnivora Ailuropoda melanoleuca HLailMel2 GCA_002007445.2 9646

88 California sea lion Carnivora Zalophus californianus HLzalCal1 GCA_009762305.1_mZalCal1.pri 9704

89 Steller sea lion Carnivora Eumetopias jubatus HLeumJub1 GCA_004028035.1 34886

90 domestic cat Carnivora Felis catus Nov. 2017 (Felis_catus_9.0/felCat9) 9685

91 jaguarundi Carnivora Puma yagouaroundi HLpumYag1 GCA_014898765.1 1608482

92 grizzly bear Carnivora Ursus arctos horribilis HLursArc1 GCA_003584765.1 116960

93 polar bear Carnivora Ursus maritimus 09 May-2014 (UrsMar_1.0/ursMar1) 29073

94 antarctic fur seal Carnivora Arctocephalus gazella HLarcGaz2 GCA_900642305.1 37190

95 American black bear Carnivora Ursus americanus HLursAme1 GCA_003344425.1 9643

96 American black bear Carnivora Ursus americanus DNA zoo Ursus americanus 9643

97 black-footed cat Carnivora Felis nigripes HLfelNig1 GCA_004023925.1_FelNig_v1_BIUU 61379

98 fossa Carnivora Cryptoprocta ferox DNA zoo Cryptoprocta ferox 94188

99 red fox Carnivora Vulpes vulpes HLvulVul1 GCA_003160815.1 9627

100 dog Carnivora Canis lupus familiaris Mar. 2020 (UU_Cfam_GSD_1.0/canFam4) 9615

101 Arctic fox Carnivora Vulpes lagopus HLvulLag1 GCA_004023825.1_VulLag_v1_BIUU 494514

102 African hunting dog Carnivora Lycaon pictus DNA zoo Lycaon pictus 9622

103 dingo Carnivora Canis lupus dingo HLcanLupDin1 GCA_003254725.1 286419

104 dog Carnivora Canis lupus familiaris May 2019 (UMICH_Zoey_3.1/canFam5) 9615

105 kinkajou Carnivora Potos flavus DNA zoo Potos flavus 29067

106 African hunting dog Carnivora Lycaon pictus HLlycPic2 GCA_004216515.1 9622

107 lesser panda Carnivora Ailurus fulgens DNA zoo Ailurus fulgens 9649

108 spotted hyena Carnivora Crocuta crocuta HLcroCro1 GCA_008692635.1 9678

109 striped hyena Carnivora Hyaena hyaena HLhyaHya1 GCA_003009895.1 95912

110 Asian palm civet Carnivora Paradoxurus hermaphroditus HLparHer1 GCA_004024585.1_ParHer_v1_BIUU 71117

111 White-nosed coati Carnivora Nasua narica DNA zoo Nasua narica 352831

112 sable Carnivora Martes zibellina HLmarZib1 GCA_012583365.1 36722

113 wolverine Carnivora Gulo gulo HLgulGul1 GCA_900006375.2 48420

114 raccoon Carnivora Procyon lotor DNA zoo Procyon lotor 9654

115 Cacomistle Carnivora Bassariscus sumichrasti DNA zoo Bassariscus sumichrasti 392507

116 western spotted skunk Carnivora Spilogale gracilis HLspiGra1 GCA_004023965.1_SpiGra_v1_BIUU 30551

117 North American badger Carnivora Taxidea taxus jeffersonii HLtaxTax1 GCA_003697995.1 2282171

118 ratel Carnivora Mellivora capensis HLmelCap1 GCA_004024625.1_MelCap_v1_BIUU 9664

119 meerkat Carnivora Suricata suricatta HLsurSur2 GCA_004023905.1_SurSur_v1_BIUU 37032

120 meerkat Carnivora Suricata suricatta HLsurSur1 GCA_006229205.1 37032

121 banded mongoose Carnivora Mungos mungo HLmunMug1 GCA_004023785.1_MunMun_v1_BIUU 210652

122 dwarf mongoose Carnivora Helogale parvula HLhelPar1 GCA_004023845.1_HelPar_v1_BIUU 210647

123 Northern American river otter Carnivora Lontra canadensis HLlonCan1 GCA_010015895.1 76717

124 giant otter Carnivora Pteronura brasiliensis DNA zoo Pteronura brasiliensis 9672

125 giant otter Carnivora Pteronura brasiliensis HLpteBra1 GCA_004024605.1_PteBra_v1_BIUU 9672

126 Southern sea otter Carnivora Enhydra lutris nereis Jun. 2019 (ASM641071v1/enhLutNer1) 1049777

127 Northern sea otter Carnivora Enhydra lutris kenyoni Sep. 2017 (ASM228890v2/enhLutKen1) 391180

128 Eurasian river otter Carnivora Lutra lutra HLlutLut1 GCA_902655055.1 9657

129 ermine Carnivora Mustela erminea HLmusErm1 GCA_009829155.1 36723

130 American mink Carnivora Neovison vison HLneoVis1 GCA_900108605.1_NNQGG.v01 452646

131 European polecat Carnivora Mustela putorius HLmusPut1 GCA_902460205.1 9668

132 domestic ferret Carnivora Mustela putorius furo HLmusFur2 GCA_011764305.1 9669

133 Brazilian tapir Laurasiatheria Tapirus terrestris HLtapTer1 GCA_004025025.1_TapTer_v1_BIUU 9801

134 greater Indian rhinoceros Laurasiatheria Rhinoceros unicornis DNA zoo Rhinoceros unicornis 9809

135 Asiatic tapir Laurasiatheria Tapirus indicus HLtapInd1 GCA_004024905.1_TapInd_v1_BIUU 9802

136 Asiatic tapir Laurasiatheria Tapirus indicus DNA zoo Tapirus indicus 9802

137 black rhinoceros Laurasiatheria Diceros bicornis HLdicBic1 GCA_004027315.2 9805

138 Sumatran rhinoceros Laurasiatheria Dicerorhinus sumatrensis sumatrensis HLdicSum1 GCA_002844835.1_ASM284483v1 310712

139 northern white rhinoceros Laurasiatheria Ceratotherium simum cottoni HLcerSimCot1 GCA_004027795.1_CerCot_v1_BIUU 310713

140 southern white rhinoceros Laurasiatheria Ceratotherium simum simum May 2012 (CerSimSim1.0/cerSim1) 73337

141 Equus burchelli boehmi Laurasiatheria Equus burchellii boehmi DNA zoo Equus burchellii boehmi 89250

142 horse Laurasiatheria Equus caballus Jan. 2018 (EquCab3.0/equCab3) 9796

143 Przewalski's horse Laurasiatheria Equus przewalskii Jun 2014 (Burgud/equPrz1) 9798

144 ass Laurasiatheria Equus asinus HLequAsi1 GCA_001305755.1_ASM130575v1 9793

145 donkey Laurasiatheria Equus asinus asinus HLequAsiAsi2 GCA_003033725.1 83772

146 Tree pangolin Laurasiatheria Manis tricuspis HLmanTri1 GCA_004765945.1 358128

147 Tree pangolin Laurasiatheria Manis tricuspis DNA zoo Manis tricuspis 358128

148 Chinese pangolin Laurasiatheria Manis pentadactyla HLmanPen2 GCA_014570555.1 143292

149 Chinese pangolin Laurasiatheria Manis pentadactyla Aug 2014 (M_pentadactyla-1.1.1/manPen1) 143292

150 Malayan pangolin Laurasiatheria Manis javanica HLmanJav1 GCA_001685135.1_ManJav1.0 9974

151 Malayan pangolin Laurasiatheria Manis javanica HLmanJav2 GCA_014570535.1 9974

152 Hispaniolan solenodon Laurasiatheria Solenodon paradoxus HLsolPar1 GCA_004363575.1_SolPar_v1_BIUU 79805

153 eastern mole Laurasiatheria Scalopus aquaticus HLscaAqu1 GCA_004024925.1_ScaAqu_v1_BIUU 71119

154 Iberian mole Laurasiatheria Talpa occidentalis HLtalOcc1 GCA_014898055.1 50954

155 gracile shrew mole Laurasiatheria Uropsilus gracilis HLuroGra1 GCA_004024945.1_UroGra_v1_BIUU 182669

156 star-nosed mole Laurasiatheria Condylura cristata Mar 2012 (ConCri1.0/conCri1) 143302

157 western European hedgehog Laurasiatheria Erinaceus europaeus May 2012 (EriEur2.0/eriEur2) 9365

158 European shrew Laurasiatheria Sorex araneus Aug. 2008 (Broad/sorAra2) 42254

159 Antarctic minke whale Cetartiodactyla Balaenoptera bonaerensis HLbalBon1 GCA_000978805.1_ASM97880v1 33556

160 grey whale Cetartiodactyla Eschrichtius robustus HLescRob1 GCA_004363415.1_EscRob_v1_BIUU 9764

161 sperm whale Cetartiodactyla Physeter catodon Sep. 2013 (Physeter_macrocephalus-2.0.2/phyCat1) 9755

162 sperm whale Cetartiodactyla Physeter catodon HLphyCat2 GCA_002837175.2 9755

163 Yangtze River dolphin Cetartiodactyla Lipotes vexillifer 31 Jul 2013 (Lipotes_vexillifer_v1/lipVex1) 118797

164 beluga whale Cetartiodactyla Delphinapterus leucas HLdelLeu2 GCA_002288925.3 9749

165 hippopotamus Cetartiodactyla Hippopotamus amphibius HLhipAmp3 GCA_004027065.2 9833

166 hippopotamus Cetartiodactyla Hippopotamus amphibius HLhipAmp1 GCA_002995585.1_ASM299558v1 9833

167 harbor porpoise Cetartiodactyla Phocoena phocoena DNA zoo Phocoena phocoena 9742

168 harbor porpoise Cetartiodactyla Phocoena phocoena HLphoPho1 GCA_004363495.1_PhoPho_v1_BIUU 9742

169 Wild Bactrian camel Cetartiodactyla Camelus ferus HLcamFer3 GCA_009834535.1 419612

170 killer whale Cetartiodactyla Orcinus orca Jan. 2013 (Oorc_1.1/orcOrc1) 9733

171 Bactrian camel Cetartiodactyla Camelus bactrianus HLcamBac1 GCA_000767855.1_Ca_bactrianus_MBC_1.0 9837

172 Indo-pacific humpbacked dolphin Cetartiodactyla Sousa chinensis HLsouChi1 GCA_007760645.1 103600

173 Arabian camel Cetartiodactyla Camelus dromedarius HLcamDro2 GCA_000803125.3 9838

174 alpaca Cetartiodactyla Vicugna pacos Mar. 2013 (Vicugna_pacos-2.0.1/vicPac2) 30538

175 common bottlenose dolphin Cetartiodactyla Tursiops truncatus HLturTru4 GCA_011762595.1_mTurTru1.mat.Y 9739

176 Indo-pacific bottlenose dolphin Cetartiodactyla Tursiops aduncus HLturAdu1 GCA_003227395.1 79784

177 Indo-pacific bottlenose dolphin Cetartiodactyla Tursiops aduncus DNA zoo Tursiops aduncus 79784

178 common bottlenose dolphin Cetartiodactyla Tursiops truncatus Oct. 2011 (Baylor Ttru_1.4/turTru2) 9739

179 common bottlenose dolphin Cetartiodactyla Tursiops truncatus HLturTru3 GCA_001922835.1_NIST_Tur_tru_v1 9739

180 pig Cetartiodactyla Sus scrofa Feb. 2017 (Sscrofa11.1/susScr11) 9823

181 okapi Cetartiodactyla Okapia johnstoni DNA zoo Okapia johnstoni 86973

182 Masai giraffe Cetartiodactyla Giraffa tippelskirchi HLgirTip1 GCA_001651235.1_ASM165123v1 439328

183 water buffalo Cetartiodactyla Bubalus bubalis HLbubBub2 GCA_003121395.1 89462

184 zebu cattle Cetartiodactyla Bos indicus HLbosInd2 GCA_002933975.1 9915

185 cow Cetartiodactyla Bos taurus Apr. 2018 (ARS-UCD1.2/bosTau9) 9913

186 wild yak Cetartiodactyla Bos mutus HLbosMut2 GCA_007646595.3 72004

187 greater kudu Cetartiodactyla Tragelaphus strepsiceros HLtraStr1 GCA_006410795.1 9946

188 aoudad Cetartiodactyla Ammotragus lervia HLammLer1 GCA_002201775.1_ALER1.0 9899

189 goat Cetartiodactyla Capra hircus HLcapHir2 GCA_001704415.1_ARS1 9925

190 wild goat Cetartiodactyla Capra aegagrus HLcapAeg1 GCA_000765075.1 9923

191 chiru Cetartiodactyla Pantholops hodgsonii May 2013 (PHO1.0/panHod1) 59538

192 white-tailed deer Cetartiodactyla Odocoileus virginianus HLodoVir3 GCA_014726795.1 9874

193 bighorn sheep Cetartiodactyla Ovis canadensis HLoviCan2 GCA_004026945.1_OviCan_v1_BIUU 37174

194 white-tailed deer Cetartiodactyla Odocoileus virginianus DNA zoo Odocoileus virginianus 9874

195 sheep Cetartiodactyla Ovis aries HLoviAri5 GCA_011170295.1 9940

196 Pere David's deer Cetartiodactyla Elaphurus davidianus HLelaDav1 GCA_002443075.1_Milu1.0 43332

197 argali Cetartiodactyla Ovis ammon HLoviAmm1 GCA_003121645.1 30527

198 North Atlantic right whale Artiodactyla Eubalaena glacialis DNA zoo Eubalaena glacialis 27606

199 North Pacific right whale Artiodactyla Eubalaena japonica HLeubJap1 GCA_004363455.1_EubJap_v1_BIUU 302098

200 minke whale Artiodactyla Balaenoptera acutorostrata scammoni Oct. 2013 (BalAcu1.0/balAcu1) 310752

201 humpback whale Artiodactyla Megaptera novaeangliae HLmegNov1 GCA_004329385.1 9773

202 Fin whale Artiodactyla Balaenoptera physalus HLbalPhy1 GCA_008795845.1 9770

203 bowhead whale Artiodactyla Balaena mysticetus HLbalMys1 27602

204 Blue whale Artiodactyla Balaenoptera musculus HLbalMus1 GCA_009873245.1 9771

205 pygmy Bryde's whale Artiodactyla Balaenoptera edeni DNA zoo Balaenoptera edeni 9769

206 Sowerby's beaked whale Artiodactyla Mesoplodon bidens HLmesBid1 GCA_004027085.1_MesBid_v1_BIUU 48745

207 Indus River dolphin Artiodactyla Platanista minor HLplaMin1 GCA_004363435.1_PlaMin_v1_BIUU 48752

208 Cuvier's beaked whale Artiodactyla Ziphius cavirostris HLzipCav1 GCA_004364475.1_ZipCav_v1_BIUU 9760

209 boutu Artiodactyla Inia geoffrensis HLlniGeo1 GCA_004363515.1_IniGeo_v1_BIUU 9725

210 narwhal Artiodactyla Monodon monoceros HLmonMon1 GCA_005190385.2 40151

211 Yangtze finless porpoise Artiodactyla Neophocaena asiaeorientalis asiaeorientalis HLneoAsi1 GCA_003031525.1_Neophocaena_asiaeorientalis_V1 1706337

212 pygmy sperm whale Artiodactyla Kogia breviceps HLkogBre1 GCA_004363705.1_KogBre_v1_BIUU 27615

213 vaquita Artiodactyla Phocoena sinus HLphoSin1 GCA_008692025.1 42100

214 franciscana Artiodactyla Pontoporia blainvillei HLponBla1 GCA_011754075.1 48723

215 Lama pacos huacaya Artiodactyla Vicugna pacos huacaya HLvicPacHua3 GCA_000767525.1_Vi_pacos_V1.0 273913

216 llama Artiodactyla Lama glama DNA zoo Lama glama 9844

217 melon-headed whale Artiodactyla Peponocephala electra DNA zoo Peponocephala electra 103596

218 long-finned pilot whale Artiodactyla Globicephala melas HLgloMel1 GCA_006547405.1 9731

219 Pacific white-sided dolphin Artiodactyla Lagenorhynchus obliquidens HLlagObl1 GCA_003676395.1 90247

220 Vicugna mensalis Artiodactyla Vicugna vicugna mensalis HLvicVicMen1 GCA_013265495.1 273917

221 guanaco Artiodactyla Lama guanicoe cacsilensis HLlamGuaCac1 GCA_013239625.1 273908

222 llama Artiodactyla Lama glama chaku HLlamGlaCha1 GCA_013239585.1 273914

223 Chacoan peccary Artiodactyla Catagonus wagneri HLcatWag1 GCA_004024745.2_CatWag_v2_BIUU_UCD 51154

224 giraffe Artiodactyla Giraffa camelopardalis HLgirCam1 GCA_006408565.1 9894

225 giraffe Artiodactyla Giraffa camelopardalis DNA zoo Giraffa camelopardalis 9894

226 African buffalo Artiodactyla Syncerus caffer HLsynCaf1 GCA_902500845.1 9970

227 Bos bison bison Artiodactyla Bison bison bison Oct. 2014 (Bison_UMD1.0/bisBis1) 43346

228 Chinese forest musk deer Artiodactyla Moschus berezovskii HLmosBer1 GCA_006459085.1 68408

229 Siberian musk deer Artiodactyla Moschus moschiferus HLmosMos1 GCA_004024705.2 68415

230 alpine musk deer Artiodactyla Moschus chrysogaster HLmosChr1 GCA_006461725.1 68412

231 Yarkand deer Artiodactyla Cervus hanglu yarkandensis HLcerHanYar1 GCA_010411085.1 84702

232 gaur Artiodactyla Bos gaurus HLbosGau1 GCA_014182915.1 9904

233 gayal Artiodactyla Bos frontalis HLbosFro1 GCA_007844835.1_NRC_Mithun_1 30520

234 white-lipped deer Artiodactyla Przewalskium albirostris HLprzAlb1 GCA_006408465.1 1088058

235 roan antelope Artiodactyla Hippotragus equinus HLhipEqu1 GCA_016433095.1 37186

236 Harvey's duiker Artiodactyla Cephalophus harveyi HLcepHar1 GCA_006410635.1 129224

237 sable antelope Artiodactyla Hippotragus niger niger HLhipNig1 GCA_006942125.1 82127

238 domestic yak Artiodactyla Bos grunniens HLbosGru1 GCA_005887515.2 30521

239 scimitar-horned oryx Artiodactyla Oryx dammah DNA zoo Oryx dammah 59534

240 bush duiker Artiodactyla Sylvicapra grimmia HLsylGri1 GCA_006408735.1 119562

241 Maxwell's duiker Artiodactyla Philantomba maxwellii HLphiMax1 GCA_006410695.1 907741

242 gemsbok Artiodactyla Oryx gazella HLoryGaz1 GCA_003945745.1 9958

243 pronghorn Artiodactyla Antilocapra americana HLantAme1 GCA_007570785.1 9891

244 Reeves' muntjac Artiodactyla Muntiacus reevesi HLmunRee1 GCA_008787405.1 9886

245 black muntjac Artiodactyla Muntiacus crinifrons HLmunCri1 GCA_006408485.1 71854

246 Central European red deer Artiodactyla Cervus elaphus hippelaphus HLcerEla1 GCA_002197005.1 46360

247 lesser kudu Artiodactyla Tragelaphus imberbis HLtraImb1 GCA_006410775.1 9947

248 brindled gnu Artiodactyla Connochaetes taurinus DNA zoo Connochaetes taurinus 9927

249 bushbuck Artiodactyla Tragelaphus scriptus HLtraScr1 GCA_006410495.1 66440

250 waterbuck Artiodactyla Kobus ellipsiprymnus HLkobEll1 GCA_006410655.1 9962

251 muntjak Artiodactyla Muntiacus muntjak HLmunMun1 GCA_008782695.1 9888

252 topi Artiodactyla Damaliscus lunatus HLdamLun1 GCA_006408505.1 9929

253 bighorn sheep Artiodactyla Ovis canadensis canadensis HLoviCan1 GCA_001039535.1 112262

254 lechwe Artiodactyla Kobus leche leche HLkobLecLec1 GCA_014926565.1 91880

255 Eastern roe deer Artiodactyla Capreolus pygargus HLcapPyg1 GCA_012922965.1 48560

256 Eurasian elk Artiodactyla Alces alces HLalcAlc1 GCA_007570765.1 9852

257 Cobus hunteri Artiodactyla Beatragus hunteri HLbeaHun1 GCA_004027495.1_BeaHun_v1_BIUU 59527

258 impala Artiodactyla Aepyceros melampus HLaepMel1 GCA_006408695.1 9897

259 mule deer Artiodactyla Odocoileus hemionus hemionus HLodoHem1 GCA_004115125.1 9877

260 Bohar reedbuck Artiodactyla Redunca redunca HLredRed1 GCA_006410935.1 59556

261 Siberian ibex Artiodactyla Capra sibirica HLcapSib1 GCA_003182615.2 72544

262 porcupine caribou Artiodactyla Rangifer tarandus granti HLranTarGra2 GCA_014898785.1 191431

263 reindeer Artiodactyla Rangifer tarandus HLranTar1 GCA_004026565.1_RanTarSib_v1_BIUU 9870

264 klipspringer Artiodactyla Oreotragus oreotragus HLoreOre1 GCA_006410675.1 66444

265 Chinese water deer Artiodactyla Hydropotes inermis HLhydIne1 GCA_006459105.1 9883

266 snow sheep Artiodactyla Ovis nivicola lydekkeri HLoviNivLyd1 GCA_903231385.1 1867112

267 suni Artiodactyla Neotragus moschatus HLneoMos1 GCA_006410615.1 66442

268 white-tailed deer Artiodactyla Odocoileus virginianus texanus HLodoVir1 GCA_002102435.1_Ovir.te_1.0 9880

269 Nilgiri tahr Artiodactyla Hemitragus hylocrius HLhemHyl1 GCA_004026825.1_HemHyl_v1_BIUU 330464

270 Asiatic mouflon Artiodactyla Ovis orientalis HLoviOri1 GCA_014523465.1 469796

271 royal antelope Artiodactyla Neotragus pygmaeus HLneoPyg1 GCA_006410875.1 1027985

272 Grant's gazelle Artiodactyla Nanger granti HLnanGra1 GCA_006408635.1 27591

273 Przewalski's gazelle Artiodactyla Procapra przewalskii HLproPrz1 GCA_006410515.1 157668

274 steenbok Artiodactyla Raphicerus campestris HLrapCam1 GCA_006410735.1 59544

275 Thomson's gazelle Artiodactyla Eudorcas thomsonii HLeudTho1 GCA_006408755.1 69308

276 springbok Artiodactyla Antidorcas marsupialis HLantMar1 GCA_006408585.1 59523

277 gerenuk Artiodactyla Litocranius walleri HLlitWal1 GCA_006410535.1 69311

278 Kirk's dik-dik Artiodactyla Madoqua kirkii HLmadKir1 GCA_006408675.1 66434

279 Hog deer Artiodactyla Axis porcinus HLaxiPor1 GCA_003798545.1 57737

280 Java mouse-deer Artiodactyla Tragulus javanicus HLtraJav1 GCA_004024965.2 9849

281 lesser mouse-deer Artiodactyla Tragulus kanchil HLtraKan1 GCA_006408655.1 1088131

282 mountain goat Artiodactyla Oreamnos americanus HLoreAme1 GCA_009758055.1 34873

283 saiga antelope Artiodactyla Saiga tatarica HLsaiTat1 GCA_004024985.1_SaiTat_v1_BIUU 34875

284 Alpine ibex Artiodactyla Capra ibex HLcapIbe1 GCA_006410555.1 72542

285 Hoffmann's two-fingered sloth Xenarthra Choloepus hoffmanni DNA zoo Choloepus hoffmanni 9358

286 southern two-toed sloth Xenarthra Choloepus didactylus HLchoDid2 GCF_015220235.1_mChoDid1.pri 27675

287 southern two-toed sloth Xenarthra Choloepus didactylus HLchoDid1 GCA_004027855.1_ChoDid_v1_BIUU 27675

288 nine-banded armadillo Xenarthra Dasypus novemcinctus Dec. 2011 (Baylor/dasNov3) 9361

289 giant anteater Xenarthra Myrmecophaga tridactyla HLmyrTri1 GCA_004026745.1_MyrTri_v1_BIUU 71006

290 southern tamandua Xenarthra Tamandua tetradactyla HLtamTet1 GCA_004025105.1_TamTet_v1_BIUU 48850

291 Southern three-banded armadillo Xenarthra Tolypeutes matacus HLtolMat1 GCA_004025125.1_TolMat_v1_BIUU 183749

292 Chinese rufous horseshoe bat Chiroptera Rhinolophus sinicus HLrhiSin1 GCA_001888835.1_ASM188883v1 89399

293 great roundleaf bat Chiroptera Hipposideros armiger HLhipArm1 GCA_001890085.1_ASM189008v1 186990

294 black flying fox Chiroptera Pteropus alecto Aug 2012 (ASM32557v1/pteAle1) 9402

295 greater horseshoe bat Chiroptera Rhinolophus ferrumequinum HLrhiFer5/Bat1K 59479

296 Bonin flying fox Chiroptera Pteropus pselaphon HLptePse1 GCA_014363405.1 1496133

297 Brazilian free-tailed bat Chiroptera Tadarida brasiliensis HLtadBra1 GCA_004025005.1_TadBra_v1_BIUU 9438

298 large flying fox Chiroptera Pteropus vampyrus HLpteVam2 GCA_000151845.2 132908

299 Malagasy flying fox Chiroptera Pteropus rufus DNA zoo Pteropus rufus 196297

300 Indian flying fox Chiroptera Pteropus giganteus HLpteGig1 GCA_902729225.1 143291

301 Malagasy straw-colored fruit bat Chiroptera Eidolon dupreanum DNA zoo Eidolon dupreanum 58063

302 straw-colored fruit bat Chiroptera Eidolon helvum DNA zoo Eidolon helvum 77214

303 Cantor's roundleaf bat Chiroptera Hipposideros galeritus HLhipGal1 GCA_004027415.1_HipGal_v1_BIUU 58069

304 lesser short-nosed fruit bat Chiroptera Cynopterus brachyotis HLcynBra1 GCA_009793145.1 58060

305 lesser dawn bat Chiroptera Eonycteris spelaea HLeonSpe1 GCA_003508835.1 58065

306 Leschenault's rousette Chiroptera Rousettus leschenaultii HLrouLes1 GCA_015472975.1 9408

307 Egyptian rousette Chiroptera Rousettus aegyptiacus HLrouAeg4/Bat1K 9407

308 Madagascan rousette Chiroptera Rousettus madagascariensis DNA zoo Rousettus madagascariensis 77223

309 Indian false vampire Chiroptera Megaderma lyra HLmegLyr2 GCA_004026885.1_MegLyr_v1_BIUU 9413

310 Pallas's mastiff bat Chiroptera Molossus molossus HLmolMol2/Bat1K 27622

311 long-tongued fruit bat Chiroptera Macroglossus sobrinus HLmacSob1 GCA_004027375.1_MacSob_v1_BIUU 326083

312 Schreibers' long-fingered bat Chiroptera Miniopterus schreibersii HLminSch1 GCA_004026525.1_MinSch_v1_BIUU 9433

313 Miniopterus schreibersii natalensis Chiroptera Miniopterus natalensis HLminNat1 GCA_001595765.1 291302

314 hog-nosed bat Chiroptera Craseonycteris thonglongyai HLcraTho1 GCA_004027555.1_CraTho_v1_BIUU 208972

315 Antillean ghost-faced bat Chiroptera Mormoops blainvillei HLmorBla1 GCA_004026545.1_MorMeg_v1_BIUU 118852

316 Parnell's mustached bat Chiroptera Pteronotus parnellii Sep. 2013 (ASM46540v1/ptePar1) 59476

317 big brown bat Chiroptera Eptesicus fuscus Jul 2012 (EptFus1.0/eptFus1) 29078

318 greater mouse-eared bat Chiroptera Myotis myotis HLmyoMyo6/Bat1K 51298

319 Brandt's bat Chiroptera Myotis brandtii 28 Jun 2013 (ASM41265v1/myoBra1) 109478

320 common vampire bat Chiroptera Desmodus rotundus HLdesRot2/Bat1K 9430

321 California big-eared bat Chiroptera Macrotus californicus HLmacCal1 GCA_007922815.1 9419

322 Northern long-eared myotis Chiroptera Myotis septentrionalis DNA zoo Myotis septentrionalis 258941

323 little brown bat Chiroptera Myotis lucifugus DNA zoo Myotis lucifugus 59463

324 little brown bat Chiroptera Myotis lucifugus Jul. 2010 (Broad Institute Myoluc2.0/myoLuc2) 59463

325 Lesser long-nosed bat Chiroptera Leptonycteris yerbabuenae HLlepYer1/GIGADB 700936

326 Vespertilio Davidii Chiroptera Myotis davidii Aug 2012 (ASM32734v1/myoDav1) 225400

327 Schizostoma hirsutum Chiroptera Micronycteris hirsuta HLmicHir1 GCA_004026765.1_MicHir_v1_BIUU 148065

328 tailed tailless bat Chiroptera Anoura caudifer HLanoCau1 GCA_004027475.1_AnoCau_v1_BIUU 27642

329 Murina feae Chiroptera Murina aurata feae HLmurAurFea1 GCA_004026665.1_MurFea_v1_BIUU 1453894

330 greater bulldog bat Chiroptera Noctilio leporinus HLnocLep1 GCA_004026585.1_NocLep_v1_BIUU 94963

331 Seba's short-tailed bat Chiroptera Carollia perspicillata HLcarPer3 GCA_004027735.1_CarPer_v1_BIUU 40233

332 pale spear-nosed bat Chiroptera Phyllostomus discolor HLphyDis3/Bat1K 89673

333 stripe-headed round-eared bat Chiroptera Tonatia saurophila HLtonSau1 GCA_004024845.1_TonSau_v1_BIUU 171122

334 Jamaican fruit-eating bat Chiroptera Artibeus jamaicensis HLartJam1 GCA_004027435.1_ArtJam_v1_BIUU 9417

335 Jamaican fruit-eating bat Chiroptera Artibeus jamaicensis HLartJam2 GCA_014825515.1 9417

336 Honduran yellow-shouldered bat Chiroptera Sturnira hondurensis HLstuHon1 GCA_014824575.1 192404

337 hoary bat Chiroptera Aeorestes cinereus HLaeoCin1 GCA_011751065.1 257879

338 pallid bat Chiroptera Antrozous pallidus HLantPal1 GCA_007922775.1 9440

339 evening bat Chiroptera Nycticeius humeralis HLnycHum2 GCA_007922795.1 27670

340 red bat Chiroptera Lasiurus borealis HLlasBor1 GCA_004026805.1_LasBor_v1_BIUU 258930

341 Kuhl's pipistrelle Chiroptera Pipistrellus kuhlii HLpipKuh2/Bat1K 59472

342 common pipistrelle Chiroptera Pipistrellus pipistrellus HLpipPip1 GCA_004026625.1_PipPip_v1_BIUU 59474

343 common pipistrelle Chiroptera Pipistrellus pipistrellus HLpipPip2 GCA_903992545.1 59474

344 gray squirrel Glires Sciurus carolinensis HLsciCar1 GCA_902686445.1 30640

345 Eurasian red squirrel Glires Sciurus vulgaris HLsciVul1 GCA_902686455.1_mSciVul1.1 55149

346 South African ground squirrel Glires Xerus inauris HLxerIna1 GCA_004024805.1_XerIna_v1_BIUU 234690

347 mountain beaver Glires Aplodontia rufa HLaplRuf1 GCA_004027875.1_AplRuf_v1_BIUU 51342

348 yellow-bellied marmot Glires Marmota flaviventris HLmarFla1 GCA_003676075.2 93162

349 Alpine marmot Glires Marmota marmota marmota HLmarMar1 GCF_001458135.1_marMar2.1 9994

350 Vancouver Island marmot Glires Marmota vancouverensis HLmarVan1 GCA_005458795.1 93167

351 Himalayan marmot Glires Marmota himalayana HLmarHim1 GCA_005280165.1 93163

352 Daurian ground squirrel Glires Spermophilus dauricus HLspeDau1 GCA_002406435.1_ASM240643v1 99837

353 woodchuck Glires Marmota monax HLmarMon1 GCA_901343595.1_MONAX5 9995

354 woodchuck Glires Marmota monax HLmarMon2 GCA_014533835.1 9995

355 Arctic ground squirrel Glires Urocitellus parryii HLuroPar1 GCA_003426925.1 9999

356 Gunnison's prairie dog Glires Cynomys gunnisoni HLcynGun1 GCA_011316645.1 45479

357 thirteen-lined ground squirrel Glires Ictidomys tridecemlineatus Nov. 2011 (Broad/speTri2) 43179

358 Fat dormouse Glires Glis glis HLgliGli1 GCA_004027185.1_GliGli_v1_BIUU 41261

359 springhare Glires Pedetes capensis HLpedCap1 GCA_007922755.1 10023

360 American beaver Glires Castor canadensis DNA zoo Castor canadensis 51338

361 woodland dormouse Glires Graphiurus murinus HLgraMur1 GCA_004027655.1_GraMur_v1_BIUU 51346

362 Mountain hare Glires Lepus timidus HLlepTim1 GCA_009760805.1 62621

363 snowshoe hare Glires Lepus americanus HLlepAme1 GCA_004026855.1_LepAme_v1_BIUU 48086

364 European rabbit Glires Oryctolagus cuniculus cuniculus HLoryCunCun4 GCA_013371645.1 568996

365 rabbit Glires Oryctolagus cuniculus Apr. 2009 (Broad/oryCun2) 9986

366 rabbit Glires Oryctolagus cuniculus HLoryCun3 GCA_009806435.1 9986

367 brush rabbit Glires Sylvilagus bachmani DNA zoo Sylvilagus bachmani 365149

368 crested porcupine Glires Hystrix cristata HLhysCri1 GCA_004026905.1_HysCri_v1_BIUU 10137

369 North American porcupine Glires Erethizon dorsatum HLereDor1 GCA_006547115.1 34844

370 Brazilian porcupine Glires Coendou prehensilis DNA zoo Coendou prehensilis 187985

371 hazel dormouse Glires Muscardinus avellanarius HLmusAve1 GCA_004027005.1_MusAve_v1_BIUU 39082

372 naked mole-rat Glires Heterocephalus glaber Jan. 2012 (Broad HetGla_female_1.0/hetGla2) 10181

373 Damara mole-rat Glires Fukomys damarensis HLfukDam2 GCA_012274545.1 885580

374 Upper Galilee mountains blind mole rat Glires Nannospalax galili Jun 2014 (S.galili_v1.0/nanGal1) 1026970

375 long-tailed chinchilla Glires Chinchilla lanigera May 2012 (ChiLan1.0/chiLan1) 34839

376 punctate agouti Glires Dasyprocta punctata HLdasPun1 GCA_004363535.1_DasPun_v1_BIUU 34846

377 northern gundi Glires Ctenodactylus gundi HLcteGun1 GCA_004027205.1_CteGun_v1_BIUU 10166

378 Gobi jerboa Glires Allactaga bullata HLallBul1 GCA_004027895.1_AllBul_v1_BIUU 1041416

379 Stephens's kangaroo rat Glires Dipodomys stephensi HLdipSte1 GCA_004024685.1_DipSte_v1_BIUU 323379

380 Ord's kangaroo rat Glires Dipodomys ordii Dec. 2014 (Dord_2.0/dipOrd2) 10020

381 hoary bamboo rat Glires Rhizomys pruinosus HLrhiPru1 GCA_009823505.1 53275

382 pacarana Glires Dinomys branickii HLdinBra1 GCA_004027595.1_DinBra_v1_BIUU 108858

383 lesser Egyptian jerboa Glires Jaculus jaculus May 2012 (JacJac1.0/jacJac1) 51337

384 meadow jumping mouse Glires Zapus hudsonius HLzapHud1 GCA_004024765.1_ZapHud_v1_BIUU 160400

385 Patagonian cavy Glires Dolichotis patagonum HLdolPat1 GCA_004027295.1_DolPat_v1_BIUU 29091

386 Pacific pocket mouse Glires Perognathus longimembris pacificus HLperLonPac1 GCA_004363475.1_PerLonPac_v1_BIUU 214514

387 capybara Glires Hydrochoerus hydrochaeris HLhydHyd1 GCA_004027455.1_HydHyd_v1_BIUU 10149

388 American pika Glires Ochotona princeps May 2012 (OchPri3.0/ochPri3) 9978

389 Brazilian guinea pig Glires Cavia aperea Jan. 2014 (CavAp1.0/cavApe1) 37548

390 dassie-rat Glires Petromus typicus HLpetTyp1 GCA_004026965.1_PetTyp_v1_BIUU 10183

391 Montane guinea pig Glires Cavia tschudii HLcavTsc1 GCA_004027695.1_CavTsc_v1_BIUU 143287

392 domestic guinea pig Glires Cavia porcellus Feb. 2008 (Broad/cavPor3) 10141

393 Greater cane rat Glires Thryonomys swinderianus HLthrSwi1 GCA_004025085.1_ThrSwi_v1_BIUU 10169

394 degu Glires Octodon degus Apr 2012 (OctDeg1.0/octDeg1) 10160

395 Gambian giant pouched rat Glires Cricetomys gambianus HLcriGam1 GCA_004027575.1_CriGam_v1_BIUU 10085

396 desert woodrat Glires Neotoma lepida HLneoLep1 GCA_001675575.1 56216

397 social tuco-tuco Glires Ctenomys sociabilis HLcteSoc1 GCA_004027165.1_CteSoc_v1_BIUU 43321

398 nutria Glires Myocastor coypus HLmyoCoy1 GCA_004027025.1_MyoCoy_v1_BIUU 10157

399 northern rock mouse Glires Peromyscus nasutus DNA zoo Peromyscus nasutus 97212

400 Chinese hamster Glires Cricetulus griseus HLcriGri3 GCA_003668045.1 10029

401 Hesperomys crinitus Glires Peromyscus crinitus DNA zoo Peromyscus crinitus 144753

402 muskrat Glires Ondatra zibethicus HLondZib1 GCA_004026605.1_OndZib_v1_BIUU 10060

403 Peromyscus californicus subsp. insignis Glires Peromyscus californicus insignis HLperCal2 GCA_007827085.2 564181

404 cactus mouse Glires Peromyscus eremicus HLperEre1 GCA_902702925.1 42410

405 southern grasshopper mouse Glires Onychomys torridus HLonyTor1 GCA_903995425.1 38674

406 golden hamster Glires Mesocricetus auratus Mar 2013 (MesAur1.0/mesAur1) 10036

407 white-footed mouse Glires Peromyscus leucopus HLperLeu1 GCA_004664715.1 10041

408 Northern mole vole Glires Ellobius talpinus HLellTal1 GCA_001685095.1_ETalpinus_0.1 329620

409 oldfield mouse Glires Peromyscus polionotus subgriseus HLperPol1 GCA_003704135.2 369710

410 prairie deer mouse Glires Peromyscus maniculatus bairdii HLperManBai2 GCA_003704035.1 230844

411 hispid cotton rat Glires Sigmodon hispidus HLsigHis1 GCA_004025045.1_SigHis_v1_BIUU 42415

412 Transcaucasian mole vole Glires Ellobius lutescens HLellLut1 GCA_001685075.1_ASM168507v1 39086

413 Bank vole Glires Myodes glareolus HLmyoGla2 GCA_902806735.1 447135

414 Eurasian water vole Glires Arvicola amphibius HLarvAmp1 GCA_903992535.1 1047088

415 fat sand rat Glires Psammomys obesus HLpsaObe1 GCA_002215935.2 48139

416 golden spiny mouse Glires Acomys russatus HLacoRus1 GCA_903995435.1 60746

417 African woodland thicket rat Glires Grammomys surdaster HLgraSur1 GCA_004785775.1 491861

418 African grass rat Glires Arvicanthis niloticus HLarvNil1 GCA_011762505.1_mArvNil1.pat.X 61156

419 root vole Glires Microtus oeconomus HLmicOec1 GCA_007455595.1 64717

420 short-tailed field vole Glires Microtus agrestis HLmicAgr2 GCA_902806775.1 29092

421 reed vole Glires Microtus fortis HLmicFor1 GCA_014885135.1 100897

422 Egyptian spiny mouse Glires Acomys cahirinus HLacoCah1 GCA_004027535.1_AcoCah_v1_BIUU 10068

423 Common vole Glires Microtus arvalis HLmicArv1 GCA_007455615.1 47230

424 prairie vole Glires Microtus ochrogaster Oct. 2012 (MicOch1.0/micOch1) 79684

425 great gerbil Glires Rhombomys opimus HLrhoOpi1 GCA_010120015.1 186474

426 southern multimammate mouse Glires Mastomys coucha HLmasCou1 GCA_008632895.1 35658

427 Mongolian gerbil Glires Meriones unguiculatus HLmerUng1 GCA_002204375.1 10047

428 black rat Glires Rattus rattus HLratRat7 GCA_011064425.1 10117

429 Norway rat Glires Rattus norvegicus HLratNor7 GCA_015227675.1 10116

430 Norway rat Glires Rattus norvegicus Jul. 2014 (RGSC 6.0/rn6) 10116

431 shrew mouse Glires Mus pahari HLmusPah1 GCA_900095145.2 10093

432 Ryukyu mouse Glires Mus caroli HLmusCar1 GCA_900094665.2_CAROLI_EIJ_v1.1 10089

433 steppe mouse Glires Mus spicilegus HLmusSpi1 GCA_003336285.1 10103

434 house mouse Glires Mus musculus Jun. 2020 (GRCm39/mm39) 10090

435 house mouse Glires Mus musculus Dec. 2011 (GRCm38/mm10) 10090

436 western wild mouse Glires Mus spretus HLmusSpr1 GCA_001624865.1_SPRET_EiJ_v1 10096

437 European woodmouse Glires Apodemus sylvaticus HLapoSyl1 GCA_001305905.1 10129

438 dugong Afrotheria Dugong dugon HLdugDug1 GCA_015147995.1 29137

439 Florida manatee Afrotheria Trichechus manatus latirostris Oct. 2011 (Broad v1.0/triMan1) 127582

440 Asiatic elephant Afrotheria Elephas maximus DNA zoo Elephas maximus 9783

441 African savanna elephant Afrotheria Loxodonta africana HLloxAfr4/Broad Institute/loxAfr4 9785

442 aardvark Afrotheria Orycteropus afer afer May 2012 (OryAfe1.0/oryAfe1) 1230840

443 Steller's sea cow Afrotheria Hydrodamalis gigas HLhydGig1 GCA_013391785.1 63631

444 Cape golden mole Afrotheria Chrysochloris asiatica Aug 2012 (ChrAsi1.0/chrAsi1) 185453

445 yellow-spotted hyrax Afrotheria Heterohyrax brucei HLhetBru1 GCA_004026845.1_HetBruBak_v1_BIUU 77598

446 Cape rock hyrax Afrotheria Procavia capensis HLproCap3 GCA_004026925.2 9813

447 Cape elephant shrew Afrotheria Elephantulus edwardii Aug 2012 (EleEdw1.0/eleEdw1) 28737

448 small Madagascar hedgehog Afrotheria Echinops telfairi Nov. 2012 (Broad/echTel2) 9371

449 Talazac's shrew tenrec Afrotheria Microgale talazaci HLmicTal1 GCA_004026705.1_MicTal_v1_BIUU 176115

450 common wombat Metatheria Vombatus ursinus HLvomUrs1 GCA_900497805.2 29139

451 koala Metatheria Phascolarctos cinereus HLphaCin1 GCA_002099425.1 38626

452 Agile Gracile Mouse Opossum Metatheria Gracilinanus agilis HLgraAgi1 GCA_016433145.1 191870

453 common brushtail Metatheria Trichosurus vulpecula HLtriVul1 GCA_011100635.1_mTriVul1.pri 9337

454 North American opossum Metatheria Didelphis virginiana DNA zoo Didelphis virginiana 9267

455 ground cuscus Metatheria Phalanger gymnotis DNA zoo Phalanger gymnotis 65615

456 gray short-tailed opossum Metatheria Monodelphis domestica Oct. 2006 (Broad/monDom5) 13616

457 Leadbeater's possum Metatheria Gymnobelideus leadbeateri HLgymLea1 GCA_011680675.1 38618

458 Tasmanian wolf Metatheria Thylacinus cynocephalus HLthyCyn1 GCA_007646695.1 9275

459 coppery ringtail possum Metatheria Pseudochirops cupreus DNA zoo Pseudochirops cupreus 37702

460 eastern gray kangaroo Metatheria Macropus giganteus DNA zoo Macropus giganteus 9317

461 golden ringtail possum Metatheria Pseudochirops corinnae DNA zoo Pseudochirops corinnae 65629

462 western gray kangaroo Metatheria Macropus fuliginosus DNA zoo Macropus fuliginosus 9316

463 tammar wallaby Metatheria Macropus eugenii DNA zoo Macropus eugenii 9315

464 red kangaroo Metatheria Osphranter rufus DNA zoo Osphranter rufus 9321

465 Western ringtail oppossum Metatheria Pseudocheirus occidentalis DNA zoo Pseudocheirus occidentalis 656515

466 tammar wallaby Metatheria Macropus eugenii Sep. 2009 (TWGS Meug_1.1/macEug2) 9315

467 yellow-footed antechinus Metatheria Antechinus flavipes HLantFla1 GCA_016432865.1_AdamAnt 38775

468 Tasmanian devil Metatheria Sarcophilus harrisii HLsarHar2 GCA_902635505.1 9305

469 platypus Monotremata Ornithorhynchus anatinus HLornAna3 GCA_004115215.1 9258

470 Australian echidna Monotremata Tachyglossus aculeatus HLtacAcu1 GCA_015852505.1 9261

Table 1. Genome assemblies included in the 470-way Conservation track.

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the size of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. Missing sequence in any assembly is highlighted in the track display by regions of yellow when zoomed out and by Ns when displayed at base level. The following conventions are used:

Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

No codon translation: The gene annotation is not used; the bases are displayed without translation.
Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation:

Gene Track Species

RefSeq Genes aardvark, American pika, Amur tiger, Angolan colobus, big brown bat, black flying fox, black snub-nosed monkey, Bolivian squirrel monkey, Brandt's bat, Cape elephant shrew, Cape golden mole, cattle, chimpanzee, Chinese tree shrew, Coquerel's sifaka, degu, dog, domestic cat, domestic guinea pig, drill, European shrew, Florida manatee, golden hamster, gray mouse lemur, green monkey, Hawaiian monk seal, horse, house mouse, house mouse, human, killer whale, lesser Egyptian jerboa, little brown bat, long-tailed chinchilla, Ma's night monkey, minke whale, naked mole-rat, nine-banded armadillo, Northern sea otter, Norway rat, Ord's kangaroo rat, Pacific walrus, Panamanian white-faced capuchin, Philippine tarsier, pig, pig-tailed macaque, polar bear, prairie vole, Przewalski's horse, pygmy chimpanzee, rabbit, Rhesus monkey, small Madagascar hedgehog, small-eared galago, sooty mangabey, southern white rhinoceros, star-nosed mole, Sumatran orangutan, thirteen-lined ground squirrel, Upper Galilee mountains blind mole rat, Vespertilio Davidii, Weddell seal, western European hedgehog, western lowland gorilla, Yangtze River dolphin

Ensembl Genes Bos bison bison, Brazilian guinea pig, dog, gray short-tailed opossum, northern tree shrew

Xeno RefGene alpaca, black lemur, Chinese pangolin, common bottlenose dolphin, proboscis monkey, Sclater's lemur, Southern sea otter, tammar wallaby

no annotation African buffalo, African grass rat, African hunting dog, African hunting dog, African savanna elephant, African woodland thicket rat, Agile Gracile Mouse Opossum, Allen's swamp monkey, Alpine ibex, Alpine marmot, alpine musk deer, American beaver, American black bear, American black bear, American mink, Amur leopard cat, antarctic fur seal, Antarctic minke whale, Antillean ghost-faced bat, aoudad, Arabian camel, Arctic fox, Arctic ground squirrel, argali, Asian black bear, Asian palm civet, Asiatic elephant, Asiatic mouflon, Asiatic tapir, Asiatic tapir, ass, Australian echidna, aye-aye, babakoto, Bactrian camel, banded mongoose, Bank vole, bearded seal, beluga whale, bighorn sheep, bighorn sheep, black muntjac, black rat, black rhinoceros, black-footed cat, black-handed spider monkey, Blue whale, Bohar reedbuck, Bolivian squirrel monkey, Bolivian titi, Bonin flying fox, boutu, bowhead whale, Brazilian free-tailed bat, Brazilian porcupine, Brazilian tapir, brindled gnu, brown lemur, brush rabbit, bush duiker, bushbuck, Cacomistle, cactus mouse, California big-eared bat, California sea lion, Canada lynx, Cantor's roundleaf bat, Cape rock hyrax, capybara, Central European red deer, Chacoan peccary, cheetah, Chinese forest musk deer, Chinese hamster, Chinese pangolin, Chinese rufous horseshoe bat, Chinese water deer, chiru, Clouded leopard, Cobus hunteri, common bottlenose dolphin, common bottlenose dolphin, common brushtail, common pipistrelle, common pipistrelle, common vampire bat, Common vole, common wombat, coppery ringtail possum, Coquerel's mouse lemur, crab-eating macaque, crested porcupine, Cuvier's beaked whale, Damara mole-rat, dassie-rat, Daurian ground squirrel, De Brazza's monkey, desert woodrat, dingo, domestic ferret, domestic yak, donkey, dugong, dwarf mongoose, eastern gray kangaroo, eastern mole, Eastern roe deer, Egyptian rousette, Egyptian spiny mouse, Equus burchelli boehmi, ermine, Eurasian elk, Eurasian red squirrel, Eurasian river otter, Eurasian water vole, European polecat, European rabbit, European woodmouse, evening bat, Fat dormouse, fat sand rat, Fin whale, fossa, franciscana, Francois's langur, Gambian giant pouched rat, gaur, gayal, gelada, gemsbok, gerenuk, giant anteater, giant otter, giant otter, giant panda, giraffe, giraffe, goat, Gobi jerboa, golden ringtail possum, golden snub-nosed monkey, golden spiny mouse, gracile shrew mole, Grant's gazelle, gray seal, gray squirrel, great gerbil, great roundleaf bat, greater bamboo lemur, greater bulldog bat, Greater cane rat, greater horseshoe bat, greater Indian rhinoceros, greater kudu, greater mouse-eared bat, grey whale, grizzly bear, ground cuscus, guanaco, Gunnison's prairie dog, Hanuman langur, harbor porpoise, harbor porpoise, harbor seal, Harvey's duiker, hazel dormouse, Hesperomys crinitus, Himalayan marmot, hippopotamus, hippopotamus, Hispaniolan solenodon, hispid cotton rat, hoary bamboo rat, hoary bat, Hoffmann's two-fingered sloth, Hog deer, hog-nosed bat, Honduran yellow-shouldered bat, humpback whale, Iberian mole, impala, Indian false vampire, Indian flying fox, Indo-pacific bottlenose dolphin, Indo-pacific bottlenose dolphin, Indo-pacific humpbacked dolphin, Indus River dolphin, jaguar, jaguar, jaguarundi, Jamaican fruit-eating bat, Jamaican fruit-eating bat, Japanese macaque, Java mouse-deer, kinkajou, Kirk's dik-dik, klipspringer, koala, Kuhl's pipistrelle, Lama pacos huacaya, large flying fox, Leadbeater's possum, lechwe, leopard, Leschenault's rousette, lesser dawn bat, Lesser dwarf lemur, lesser kudu, Lesser long-nosed bat, lesser mouse-deer, lesser panda, lesser short-nosed fruit bat, lion, little brown bat, llama, llama, long-finned pilot whale, long-tongued fruit bat, Madagascan rousette, Malagasy flying fox, Malagasy straw-colored fruit bat, Malayan pangolin, Malayan pangolin, mandrill, mantled howler monkey, Masai giraffe, Maxwell's duiker, meadow jumping mouse, meerkat, meerkat, melon-headed whale, Miniopterus schreibersii natalensis, Mona monkey, Mongolian gerbil, mongoose lemur, Montane guinea pig, mountain beaver, mountain goat, Mountain hare, mouse lemur, mule deer, muntjak, Murina feae, muskrat, narwhal, Nilgiri tahr, North American badger, North American opossum, North American porcupine, North Atlantic right whale, North Pacific right whale, Northern American river otter, Northern elephant seal, northern fur seal, Northern giant mouse lemur, northern gundi, Northern long-eared myotis, Northern mole vole, northern rock mouse, Northern rufous mouse lemur, northern white rhinoceros, northern white-cheeked gibbon, Norway rat, nutria, okapi, oldfield mouse, olive baboon, pacarana, Pacific pocket mouse, Pacific white-sided dolphin, pale spear-nosed bat, Pallas's mastiff bat, pallid bat, Parnell's mustached bat, Patagonian cavy, Pere David's deer, Peromyscus californicus subsp. insignis, platypus, porcupine caribou, prairie deer mouse, pronghorn, Przewalski's gazelle, puma, punctate agouti, pygmy Bryde's whale, pygmy marmoset, pygmy sperm whale, rabbit, raccoon, ratel, red bat, red fox, red guenon, red kangaroo, Red shanked douc langur, reed vole, Reeves' muntjac, reindeer, Ring-tailed lemur, roan antelope, root vole, royal antelope, Ryukyu mouse, sable, sable antelope, saiga antelope, Schizostoma hirsutum, Schreibers' long-fingered bat, scimitar-horned oryx, Sclater's lemur, Seba's short-tailed bat, sheep, short-tailed field vole, shrew mouse, Siberian ibex, Siberian musk deer, silvery gibbon, slow loris, snow sheep, snowshoe hare, social tuco-tuco, South African ground squirrel, Southern elephant seal, southern grasshopper mouse, southern multimammate mouse, southern tamandua, Southern three-banded armadillo, southern two-toed sloth, southern two-toed sloth, Sowerby's beaked whale, Spanish lynx, sperm whale, sperm whale, spotted hyena, springbok, springhare, steenbok, Steller sea lion, Steller's sea cow, Stephens's kangaroo rat, steppe mouse, straw-colored fruit bat, stripe-headed round-eared bat, striped hyena, Sumatran rhinoceros, Sunda flying lemur, suni, tailed tailless bat, Talazac's shrew tenrec, tamarin, tammar wallaby, Tasmanian devil, Tasmanian wolf, Thomson's gazelle, topi, Transcaucasian mole vole, Tree pangolin, Tree pangolin, tufted capuchin, Ugandan red Colobus, Vancouver Island marmot, vaquita, Vicugna mensalis, walrus, water buffalo, waterbuck, western gray kangaroo, Western ringtail oppossum, western spotted skunk, western wild mouse, white-faced saki, white-footed mouse, white-fronted capuchin, white-lipped deer, White-nosed coati, white-tailed deer, white-tailed deer, white-tailed deer, white-tufted-ear marmoset, Wild Bactrian camel, wild goat, wild yak, wolverine, woodchuck, woodchuck, woodland dormouse, Yangtze finless porpoise, Yarkand deer, yellow-bellied marmot, yellow-footed antechinus, yellow-spotted hyrax, zebu cattle,

Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net.

Phylogenetic Tree Model

The phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all-species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 470-way alignment (msa_view). The 4d sites were derived from the RefSeq (Reviewed+Coding) gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations; however, the background frequencies were modified to maintain reversibility. The resulting tree model: all species.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements ( http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Credits

This track was created using the following programs:

Alignment tools: lastz (formerly blastz) and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
Tree image generator: phyloPng by Galt Barber, UCSC
Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

References

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 2007.

PhyloP:

Cooper GM, Stone EA, Asimenos G, NISC Comparative Sequencing Program., Green ED, Batzoglou S, Sidow A. Distribution and intensity of constraint in mammalian genomic sequence. Genome Res. 2005 Jul;15(7):901-13. PMID: 15965027; PMC: PMC1172034; DOI: 10.1101/gr.3577405

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 2010 Jan;20(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 2005. pp. 325-351. DOI: 10.1007/0-387-27733-1_12

Siepel A, Pollard KS, and Haussler D. New methods for detecting lineage-specific selection. In Proceedings of the 10th International Conference on Research in Computational Molecular Biology (RECOMB 2006), pp. 190-205. DOI: 10.1007/11732990_17