Schema for Avada Variants - Avada Variants extracted from full text publications
|
|
Database: hg19 Primary Table: avada Data last updated: 2020-04-27
Big Bed File Download: /gbdb/hg19/bbi/avada.bb Item Count: 613,524 The data is stored in the binary BigBed format.
Format description: AVADA variant information
field | example | description |
chrom | chr1 | Chromosome (or contig, scaffold, etc.) | chromStart | 167368446 | Start position in chromosome | chromEnd | 167368447 | End position in chromosome | name | I421F | Name of item | score | 0 | Score from 0-1000 | strand | + | + or - | thickStart | 167368446 | Start of where display should be thick (start codon) | thickEnd | 167368447 | End of where display should be thick (stop codon) | reserved | 0 | Used as itemRgb as of 2004-11-22 | geneSym | POU2F1 | Gene Symbol | variant | I421F | Variant as in Paper | ensId | ENSG00000143190 | Gene (Ensembl) | entrezs | 5451 | Gene (Entrez) | refSeq | NP_001185712.1 | Transcript (RefSeq) | pmid | 25398212 | Pubmed ID | title | Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa. | Title | authors | Du Plessis, Morne; Pearce, Brendon; Jacobs, Clifford; Hoosain, Nisreen; Benjeddou, Mongi | Authors | ref | Molecular biology reports 2015, 42(3):p. 665-72 | Reference | doi | 10.1007/s11033-014-3813-2 | DOI | abstract | Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively. | Abstract | _mouseOver | I421F in: Du 2015 - Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa. | mouse over text |
|
| |
|
|
Sample Rows
|
|
chrom | chromStart | chromEnd | name | score | strand | thickStart | thickEnd | reserved | geneSym | variant | ensId | entrezs | refSeq | pmid | title | authors | ref | doi | abstract | _mouseOver |
chr1 | 167368446 | 167368447 | I421F | 0 | + | 167368446 | 167368447 | 0 | POU2F1 | I421F | ENSG00000143190 | 5451 | NP_001185712.1 | 25398212 | Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa. | Du Plessis, Morne; Pearce, Brendon; Jacobs, Clifford; Hoosain, Nisreen; Benjeddou, Mongi | Molecular biology reports 2015, 42(3):p. 665-72 | 10.1007/s11033-014-3813-2 | Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of vario ... | I421F in: Du 2015 - Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population ... |
chr1 | 167370772 | 167370773 | V501E | 0 | + | 167370772 | 167370773 | 0 | POU2F1 | V501E | ENSG00000143190 | 5451 | NP_001185712.1 | 25398212 | Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa. | Du Plessis, Morne; Pearce, Brendon; Jacobs, Clifford; Hoosain, Nisreen; Benjeddou, Mongi | Molecular biology reports 2015, 42(3):p. 665-72 | 10.1007/s11033-014-3813-2 | Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of vario ... | V501E in: Du 2015 - Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population ... |
chr1 | 167388745 | 167388746 | 6000T/A | 0 | + | 167388745 | 167388746 | 0 | POU2F1 | 6000T/A | ENSG00000143190 | 5451 | NM_002697.3 | 15786443 | Identification of hippocampus-related candidate genes for Alzheimer's disease. | Taguchi, Keiko; Yamagata, Hidehisa D; Zhong, Wangtao; Kamino, Kouzin; Akatsu, Hiroyasu; Hata, Ryuji; Yamamoto, Takayuki; Kosaka, ... | Annals of neurology 2005, 57(4):p. 585-8 | 10.1002/ana.20433 | Alzheimer's disease (AD) is a complex multifactorial disease in which many genetic and environmental factors are involved. We pe ... | 6000T/A in: Taguchi 2005 - Identification of hippocampus-related candidate genes for Alzheimer's disease. |
chr1 | 167388934 | 167388935 | 6000T/A | 0 | + | 167388934 | 167388935 | 0 | POU2F1 | 6000T/A | ENSG00000143190 | 5451 | NM_001198786.1 | 15786443 | Identification of hippocampus-related candidate genes for Alzheimer's disease. | Taguchi, Keiko; Yamagata, Hidehisa D; Zhong, Wangtao; Kamino, Kouzin; Akatsu, Hiroyasu; Hata, Ryuji; Yamamoto, Takayuki; Kosaka, ... | Annals of neurology 2005, 57(4):p. 585-8 | 10.1002/ana.20433 | Alzheimer's disease (AD) is a complex multifactorial disease in which many genetic and environmental factors are involved. We pe ... | 6000T/A in: Taguchi 2005 - Identification of hippocampus-related candidate genes for Alzheimer's disease. |
chr1 | 167395263 | 167395264 | 12329A/G | 0 | + | 167395263 | 167395264 | 0 | POU2F1 | 12329A/G | ENSG00000143190 | 5451 | NM_001198786.1 | 15786443 | Identification of hippocampus-related candidate genes for Alzheimer's disease. | Taguchi, Keiko; Yamagata, Hidehisa D; Zhong, Wangtao; Kamino, Kouzin; Akatsu, Hiroyasu; Hata, Ryuji; Yamamoto, Takayuki; Kosaka, ... | Annals of neurology 2005, 57(4):p. 585-8 | 10.1002/ana.20433 | Alzheimer's disease (AD) is a complex multifactorial disease in which many genetic and environmental factors are involved. We pe ... | 12329A/G in: Taguchi 2005 - Identification of hippocampus-related candidate genes for Alzheimer's disease. |
chr1 | 167396328 | 167396329 | 13583T/C | 0 | + | 167396328 | 167396329 | 0 | POU2F1 | 13583T/C | ENSG00000143190 | 5451 | NM_002697.3 | 15786443 | Identification of hippocampus-related candidate genes for Alzheimer's disease. | Taguchi, Keiko; Yamagata, Hidehisa D; Zhong, Wangtao; Kamino, Kouzin; Akatsu, Hiroyasu; Hata, Ryuji; Yamamoto, Takayuki; Kosaka, ... | Annals of neurology 2005, 57(4):p. 585-8 | 10.1002/ana.20433 | Alzheimer's disease (AD) is a complex multifactorial disease in which many genetic and environmental factors are involved. We pe ... | 13583T/C in: Taguchi 2005 - Identification of hippocampus-related candidate genes for Alzheimer's disease. |
chr1 | 167402274 | 167402275 | 411insC | 0 | - | 167402274 | 167402275 | 0 | CD247 | 411insC | ENSG00000198821 | 919 | NM_000734.3 | 17170122 | T-B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3zeta subunit of the T-cell antigen receptor com ... | Roberts, Joseph L; Lauritsen, Jens Peter H; Cooney, Myriah; Parrott, Roberta E; Sajaroff, Elisa O; Win, Chan M; Keller, Mich...p ... | Blood 2007, 109(8):p. 3198-206 | 10.1182/blood-2006-08-043166 | CD3zeta is a subunit of the T-cell antigen receptor (TCR) complex required for its assembly and surface expression that also pla ... | 411insC in: Roberts 2007 - T-B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3zeta subunit of the ... |
chr1 | 167402276 | 167402277 | 411insC | 0 | - | 167402276 | 167402277 | 0 | CD247 | 411insC | ENSG00000198821 | 919 | NM_198053.2 | 17170122 | T-B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3zeta subunit of the T-cell antigen receptor com ... | Roberts, Joseph L; Lauritsen, Jens Peter H; Cooney, Myriah; Parrott, Roberta E; Sajaroff, Elisa O; Win, Chan M; Keller, Mich...p ... | Blood 2007, 109(8):p. 3198-206 | 10.1182/blood-2006-08-043166 | CD3zeta is a subunit of the T-cell antigen receptor (TCR) complex required for its assembly and surface expression that also pla ... | 411insC in: Roberts 2007 - T-B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3zeta subunit of the ... |
chr1 | 167408590 | 167408591 | Q70L | 0 | - | 167408590 | 167408591 | 0 | CD247 | Q70L | ENSG00000198821 | 919 | NP_000725.1 | 16672702 | Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency. | Rieux-Laucat, Frédéric; Hivroz, Claire; Lim, Annick; Mateo, Véronique; Pellier, Isabelle; Selz, Françoise; Fischer, Alain; Le De ... | The New England journal of medicine 2006, 354(18):p. 1913-21 | 10.1056/NEJMoa053750 | A four-month-old boy with primary immunodeficiency was found to have a homozygous germ-line mutation of the gene encoding the CD ... | Q70L in: Rieux-Laucat 2006 - Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency. |
chr1 | 167408591 | 167408592 | Q70X | 0 | - | 167408591 | 167408592 | 0 | CD247 | Q70X | ENSG00000198821 | 919 | NP_000725.1 | 16672702 | Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency. | Rieux-Laucat, Frédéric; Hivroz, Claire; Lim, Annick; Mateo, Véronique; Pellier, Isabelle; Selz, Françoise; Fischer, Alain; Le De ... | The New England journal of medicine 2006, 354(18):p. 1913-21 | 10.1056/NEJMoa053750 | A four-month-old boy with primary immunodeficiency was found to have a homozygous germ-line mutation of the gene encoding the CD ... | Q70X in: Rieux-Laucat 2006 - Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency. |
|
| |
|
|
Avada Variants (avada) Track Description
|
|
Description
This track shows the genomic positions of variants in the
AVADA database.
AVADA is a database of variants built by a machine learning software
that analyzes full text research articles to find the gene mentions in the text that
look like they are most relevant for monogenic (non-cancer) genetic diagnosis, finds variant
descriptions and uses the genes to map the variants to the genome. For details see the
AVADA paper.
As the data is automatically extracted from full-text publications, it includes
some false positives. In the original study, out of 200 randomly selected articles,
only 99 were considered relevant after manual curation. However, this share is very high
compared to the Genomenom track. Ideally, the track is used
in combination with variants found in human patients, to find relevant literature,
or with Genome Browser tracks of variant databases that curated a single study
for each variant, like our tracks for HGMD or LOVD.
Display Conventions and Configuration
Genomic locations of a variants are labeled with the variant description
in the original text. This is not a normalized HGVS string, but the original
text as the authors of the study described it.
The Pubmed ID, gene and transcript for each variant are shown on the
variant's details page, as well as the PubMed title, authors, and abstract.
Mouse over the variants to show the gene, variant, first author, year, and title.
The data has been lifted from hg19 to hg38.
Data access
The raw data can be explored interactively with the Table Browser,
for download, intersection or correlations with other tracks. To join this track with others
based on the chromosome positions, use the Data Integrator.
For automated download and analysis, the genome annotation is stored in a bigBed file that
can be downloaded from
our download server.
The file for this track is called avada.bb. Individual
regions or the whole genome annotation can be obtained using our tool bigBedToBed
which can be compiled from the source code or downloaded as a precompiled
binary for your system. Instructions for downloading source code and binaries can be found
here.
The tool
can also be used to obtain only features within a given range, e.g.
bigBedToBed http://hgdownload.soe.ucsc.edu/gbdb/hg19/bbi/avada.bb -chrom=chr21 -start=0 -end=100000000 stdout
For automated access, this track like all others, is also available via our
API. However, for bulk processing in
pipelines, downloading the data and/or using bigBed files as described above is
usually faster.
Methods
The AVADA VCF file was reformatted at UCSC to the bigBed format.
The program that performs the conversion is available on
Github. The paper reference information was added from
MEDLINE and is used Courtesy of the U.S. National Library of Medicine, according
to its
Terms and Conditions.
Credits
Thanks to Gill Bejerano and Johannes Birgmeier for making the data available.
References
Johannes Birgmeier, Cole A. Deisseroth, Laura E. Hayward, Luisa M. T. Galhardo, Andrew P. Tierno, Karthik A. Jagadeesh, Peter D. Stenson, David N. Cooper, Jonathan A. Bernstein, Maximilian Haeussler, and Gill Bejerano.
AVADA: Towards Automated Pathogenic Variant Evidence Retrieval Directly from the Full Text Literature. .
Genetics in Medicine. 2019.
PMID: 31467448
| |
|
|
|